MultiQC Report

General Statistics

Showing 702 samples.

Created with MultiQC

Sample status checks

Reports on sample strandedness status, and any failures in trimming or mapping.

Strandedness Checks

Showing ⁰/₄₆₈ rows and ⁷/₇ columns.

Sample	Status	Strand inference method	Provided strandedness	Inferred strandedness	Sense (%)	Antisense (%)	Unstranded (%)
ERX1946678	pass	RSeQC	auto	unstranded	49.2	49.0	1.8
ERX1946678	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946679	pass	RSeQC	auto	unstranded	49.5	48.6	2.0
ERX1946679	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946680	pass	RSeQC	auto	unstranded	49.5	48.7	1.8
ERX1946680	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946681	pass	RSeQC	auto	unstranded	50.1	48.3	1.7
ERX1946681	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946682	pass	RSeQC	auto	unstranded	49.8	48.5	1.7
ERX1946682	pass	Salmon	auto	unstranded	50.7	49.3	0.0
ERX1946683	pass	RSeQC	auto	unstranded	50.0	48.5	1.4
ERX1946683	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946684	pass	RSeQC	auto	unstranded	49.5	48.5	2.0
ERX1946684	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946685	pass	RSeQC	auto	unstranded	49.7	48.6	1.7
ERX1946685	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946686	pass	RSeQC	auto	unstranded	49.5	48.9	1.6
ERX1946686	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946687	pass	RSeQC	auto	unstranded	49.7	48.9	1.4
ERX1946687	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946688	pass	RSeQC	auto	unstranded	49.7	49.0	1.3
ERX1946688	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946689	pass	RSeQC	auto	unstranded	50.0	48.9	1.1
ERX1946689	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946690	pass	RSeQC	auto	unstranded	49.9	49.2	0.9
ERX1946690	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946691	pass	RSeQC	auto	unstranded	50.0	49.0	1.0
ERX1946691	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946692	pass	RSeQC	auto	unstranded	49.2	49.7	1.0
ERX1946692	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946693	pass	RSeQC	auto	unstranded	49.8	49.1	1.1
ERX1946693	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946694	pass	RSeQC	auto	unstranded	49.4	49.4	1.2
ERX1946694	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946695	pass	RSeQC	auto	unstranded	49.3	49.1	1.6
ERX1946695	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946696	pass	RSeQC	auto	unstranded	49.8	48.9	1.3
ERX1946696	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946697	pass	RSeQC	auto	unstranded	49.7	48.9	1.4
ERX1946697	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946698	pass	RSeQC	auto	unstranded	49.7	48.8	1.4
ERX1946698	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946699	pass	RSeQC	auto	unstranded	49.8	48.8	1.4
ERX1946699	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946700	pass	RSeQC	auto	unstranded	49.7	49.0	1.3
ERX1946700	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946701	pass	RSeQC	auto	unstranded	49.5	49.0	1.5
ERX1946701	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946702	pass	RSeQC	auto	unstranded	49.8	48.7	1.5
ERX1946702	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946703	pass	RSeQC	auto	unstranded	49.3	49.0	1.6
ERX1946703	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946704	pass	RSeQC	auto	unstranded	49.6	48.7	1.7
ERX1946704	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946705	pass	RSeQC	auto	unstranded	49.7	48.6	1.7
ERX1946705	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946706	pass	RSeQC	auto	unstranded	49.9	48.6	1.6
ERX1946706	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946707	pass	RSeQC	auto	unstranded	49.5	48.8	1.7
ERX1946707	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946708	pass	RSeQC	auto	unstranded	49.6	48.8	1.6
ERX1946708	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946709	pass	RSeQC	auto	unstranded	49.6	48.9	1.5
ERX1946709	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946710	pass	RSeQC	auto	unstranded	49.5	48.8	1.7
ERX1946710	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946711	pass	RSeQC	auto	unstranded	49.4	48.9	1.7
ERX1946711	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946712	pass	RSeQC	auto	unstranded	49.7	48.6	1.7
ERX1946712	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946713	pass	RSeQC	auto	unstranded	49.5	49.0	1.5
ERX1946713	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946714	pass	RSeQC	auto	unstranded	49.7	49.0	1.3
ERX1946714	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946715	pass	RSeQC	auto	unstranded	50.0	48.8	1.2
ERX1946715	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946716	pass	RSeQC	auto	unstranded	50.0	48.8	1.2
ERX1946716	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946717	pass	RSeQC	auto	unstranded	50.0	49.0	1.1
ERX1946717	pass	Salmon	auto	unstranded	50.9	49.1	0.0
ERX1946718	pass	RSeQC	auto	unstranded	49.6	49.1	1.3
ERX1946718	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946719	pass	RSeQC	auto	unstranded	49.5	49.2	1.3
ERX1946719	pass	Salmon	auto	unstranded	50.6	49.4	0.0
ERX1946720	pass	RSeQC	auto	unstranded	49.8	48.8	1.4
ERX1946720	pass	Salmon	auto	unstranded	50.9	49.1	0.0
ERX1946721	pass	RSeQC	auto	unstranded	49.9	48.8	1.3
ERX1946721	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946722	pass	RSeQC	auto	unstranded	50.0	48.7	1.4
ERX1946722	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946723	pass	RSeQC	auto	unstranded	49.3	49.3	1.4
ERX1946723	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946724	pass	RSeQC	auto	unstranded	49.8	48.9	1.3
ERX1946724	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946725	pass	RSeQC	auto	unstranded	49.6	48.9	1.4
ERX1946725	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946726	pass	RSeQC	auto	unstranded	49.6	49.0	1.3
ERX1946726	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946727	pass	RSeQC	auto	unstranded	49.5	48.9	1.6
ERX1946727	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946728	pass	RSeQC	auto	unstranded	49.6	48.9	1.5
ERX1946728	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946729	pass	RSeQC	auto	unstranded	49.6	48.9	1.4
ERX1946729	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946730	pass	RSeQC	auto	unstranded	49.4	48.8	1.8
ERX1946730	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946731	pass	RSeQC	auto	unstranded	49.4	48.8	1.8
ERX1946731	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946732	pass	RSeQC	auto	unstranded	49.5	48.6	2.0
ERX1946732	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946733	pass	RSeQC	auto	unstranded	49.5	48.7	1.8
ERX1946733	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946734	pass	RSeQC	auto	unstranded	49.7	48.5	1.8
ERX1946734	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946735	pass	RSeQC	auto	unstranded	49.7	48.6	1.7
ERX1946735	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946736	pass	RSeQC	auto	unstranded	49.5	48.7	1.7
ERX1946736	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946737	pass	RSeQC	auto	unstranded	49.7	48.7	1.6
ERX1946737	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946738	pass	RSeQC	auto	unstranded	49.2	49.1	1.6
ERX1946738	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946739	pass	RSeQC	auto	unstranded	49.7	48.7	1.6
ERX1946739	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946740	pass	RSeQC	auto	unstranded	49.5	48.9	1.6
ERX1946740	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946741	pass	RSeQC	auto	unstranded	50.2	48.4	1.4
ERX1946741	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946742	pass	RSeQC	auto	unstranded	50.1	49.1	0.8
ERX1946742	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946743	pass	RSeQC	auto	unstranded	49.6	49.0	1.4
ERX1946743	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946744	pass	RSeQC	auto	unstranded	49.5	49.3	1.2
ERX1946744	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946745	pass	RSeQC	auto	unstranded	49.3	49.3	1.4
ERX1946745	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946746	pass	RSeQC	auto	unstranded	49.5	49.0	1.5
ERX1946746	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946747	pass	RSeQC	auto	unstranded	50.0	48.9	1.2
ERX1946747	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946748	pass	RSeQC	auto	unstranded	49.8	49.0	1.2
ERX1946748	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946749	pass	RSeQC	auto	unstranded	50.0	48.8	1.2
ERX1946749	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946750	pass	RSeQC	auto	unstranded	49.7	49.0	1.3
ERX1946750	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946751	pass	RSeQC	auto	unstranded	49.6	49.1	1.3
ERX1946751	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946752	pass	RSeQC	auto	unstranded	49.3	49.3	1.4
ERX1946752	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946753	pass	RSeQC	auto	unstranded	49.7	49.0	1.3
ERX1946753	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946754	pass	RSeQC	auto	unstranded	49.5	49.1	1.4
ERX1946754	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946755	pass	RSeQC	auto	unstranded	49.5	49.0	1.4
ERX1946755	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946756	pass	RSeQC	auto	unstranded	49.5	48.9	1.6
ERX1946756	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946757	pass	RSeQC	auto	unstranded	49.7	48.8	1.5
ERX1946757	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946758	pass	RSeQC	auto	unstranded	49.2	49.2	1.6
ERX1946758	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946759	pass	RSeQC	auto	unstranded	49.3	49.1	1.5
ERX1946759	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946760	pass	RSeQC	auto	unstranded	49.3	49.2	1.5
ERX1946760	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946761	pass	RSeQC	auto	unstranded	49.5	49.1	1.4
ERX1946761	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946762	pass	RSeQC	auto	unstranded	49.9	48.9	1.2
ERX1946762	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946763	pass	RSeQC	auto	unstranded	49.9	48.8	1.3
ERX1946763	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946764	pass	RSeQC	auto	unstranded	49.4	49.3	1.3
ERX1946764	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946765	pass	RSeQC	auto	unstranded	49.5	49.1	1.4
ERX1946765	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946766	pass	RSeQC	auto	unstranded	49.5	49.1	1.4
ERX1946766	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946767	pass	RSeQC	auto	unstranded	49.5	49.1	1.4
ERX1946767	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946768	pass	RSeQC	auto	unstranded	49.8	48.8	1.4
ERX1946768	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946769	pass	RSeQC	auto	unstranded	49.7	48.9	1.4
ERX1946769	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946770	pass	RSeQC	auto	unstranded	49.2	49.3	1.4
ERX1946770	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946771	pass	RSeQC	auto	unstranded	49.7	48.4	1.9
ERX1946771	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946772	pass	RSeQC	auto	unstranded	49.7	48.6	1.8
ERX1946772	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946773	pass	RSeQC	auto	unstranded	49.7	48.4	1.9
ERX1946773	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946774	pass	RSeQC	auto	unstranded	49.5	48.7	1.8
ERX1946774	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946775	pass	RSeQC	auto	unstranded	49.5	48.7	1.8
ERX1946775	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946776	pass	RSeQC	auto	unstranded	49.7	48.5	1.7
ERX1946776	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946777	pass	RSeQC	auto	unstranded	49.7	48.7	1.6
ERX1946777	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946778	pass	RSeQC	auto	unstranded	50.0	48.4	1.6
ERX1946778	pass	Salmon	auto	unstranded	50.6	49.4	0.0
ERX1946779	pass	RSeQC	auto	unstranded	49.6	49.1	1.4
ERX1946779	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946780	pass	RSeQC	auto	unstranded	49.4	48.6	2.0
ERX1946780	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946781	pass	RSeQC	auto	unstranded	49.5	48.8	1.7
ERX1946781	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946782	pass	RSeQC	auto	unstranded	49.4	49.0	1.5
ERX1946782	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946783	pass	RSeQC	auto	unstranded	49.8	48.9	1.3
ERX1946783	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946784	pass	RSeQC	auto	unstranded	49.8	48.9	1.4
ERX1946784	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946785	pass	RSeQC	auto	unstranded	50.0	48.8	1.3
ERX1946785	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946786	pass	RSeQC	auto	unstranded	50.0	48.9	1.1
ERX1946786	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946787	pass	RSeQC	auto	unstranded	50.1	48.9	1.0
ERX1946787	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946788	pass	RSeQC	auto	unstranded	50.1	48.6	1.3
ERX1946788	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946789	pass	RSeQC	auto	unstranded	49.7	49.3	1.0
ERX1946789	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946790	pass	RSeQC	auto	unstranded	50.0	48.8	1.1
ERX1946790	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946791	pass	RSeQC	auto	unstranded	49.6	48.6	1.8
ERX1946791	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946792	pass	RSeQC	auto	unstranded	49.6	49.1	1.3
ERX1946792	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946793	pass	RSeQC	auto	unstranded	49.9	48.8	1.3
ERX1946793	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946794	pass	RSeQC	auto	unstranded	49.5	49.1	1.4
ERX1946794	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946795	pass	RSeQC	auto	unstranded	49.5	49.0	1.4
ERX1946795	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946796	pass	RSeQC	auto	unstranded	49.8	48.9	1.3
ERX1946796	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946797	pass	RSeQC	auto	unstranded	49.4	49.0	1.7
ERX1946797	pass	Salmon	auto	unstranded	50.0	50.0	0.0
ERX1946798	pass	RSeQC	auto	unstranded	49.4	49.1	1.5
ERX1946798	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946799	pass	RSeQC	auto	unstranded	49.4	49.0	1.6
ERX1946799	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946800	pass	RSeQC	auto	unstranded	49.3	48.9	1.8
ERX1946800	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946801	pass	RSeQC	auto	unstranded	49.4	48.8	1.8
ERX1946801	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946802	pass	RSeQC	auto	unstranded	49.6	48.8	1.6
ERX1946802	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946803	pass	RSeQC	auto	unstranded	49.5	48.8	1.7
ERX1946803	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946804	pass	RSeQC	auto	unstranded	49.5	48.8	1.6
ERX1946804	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946805	pass	RSeQC	auto	unstranded	49.3	49.3	1.4
ERX1946805	pass	Salmon	auto	unstranded	50.0	50.0	0.0
ERX1946806	pass	RSeQC	auto	unstranded	49.5	48.8	1.7
ERX1946806	pass	Salmon	auto	unstranded	50.0	50.0	0.0
ERX1946807	pass	RSeQC	auto	unstranded	49.3	49.0	1.7
ERX1946807	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946808	pass	RSeQC	auto	unstranded	49.3	49.0	1.7
ERX1946808	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946809	pass	RSeQC	auto	unstranded	49.1	49.2	1.7
ERX1946809	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946810	pass	RSeQC	auto	unstranded	49.5	49.0	1.5
ERX1946810	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946811	pass	RSeQC	auto	unstranded	49.9	48.9	1.2
ERX1946811	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946812	pass	RSeQC	auto	unstranded	49.9	48.9	1.3
ERX1946812	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946813	pass	RSeQC	auto	unstranded	50.5	48.4	1.1
ERX1946813	pass	Salmon	auto	unstranded	50.8	49.2	0.0
ERX1946814	pass	RSeQC	auto	unstranded	49.6	49.2	1.1
ERX1946814	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946815	pass	RSeQC	auto	unstranded	49.5	49.1	1.4
ERX1946815	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946816	pass	RSeQC	auto	unstranded	49.6	49.0	1.4
ERX1946816	pass	Salmon	auto	unstranded	50.6	49.4	0.0
ERX1946817	pass	RSeQC	auto	unstranded	50.0	48.7	1.3
ERX1946817	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946818	pass	RSeQC	auto	unstranded	49.8	48.9	1.3
ERX1946818	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946819	pass	RSeQC	auto	unstranded	49.3	49.4	1.4
ERX1946819	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946820	pass	RSeQC	auto	unstranded	49.7	48.9	1.4
ERX1946820	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946821	pass	RSeQC	auto	unstranded	49.8	48.8	1.4
ERX1946821	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946822	pass	RSeQC	auto	unstranded	49.5	49.3	1.3
ERX1946822	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946823	pass	RSeQC	auto	unstranded	49.3	49.2	1.5
ERX1946823	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946824	pass	RSeQC	auto	unstranded	49.6	49.0	1.4
ERX1946824	pass	Salmon	auto	unstranded	50.0	50.0	0.0
ERX1946825	pass	RSeQC	auto	unstranded	49.7	48.9	1.4
ERX1946825	pass	Salmon	auto	unstranded	50.0	50.0	0.0
ERX1946826	pass	RSeQC	auto	unstranded	49.2	48.9	1.8
ERX1946826	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946827	pass	RSeQC	auto	unstranded	49.3	49.0	1.7
ERX1946827	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946828	pass	RSeQC	auto	unstranded	49.2	48.9	1.9
ERX1946828	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946829	pass	RSeQC	auto	unstranded	49.5	48.8	1.8
ERX1946829	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946830	pass	RSeQC	auto	unstranded	49.7	48.6	1.7
ERX1946830	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946831	pass	RSeQC	auto	unstranded	49.6	48.8	1.7
ERX1946831	pass	Salmon	auto	unstranded	50.0	50.0	0.0
ERX1946832	pass	RSeQC	auto	unstranded	49.1	49.2	1.8
ERX1946832	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946833	pass	RSeQC	auto	unstranded	49.4	48.9	1.7
ERX1946833	pass	Salmon	auto	unstranded	50.0	50.0	0.0
ERX1946834	pass	RSeQC	auto	unstranded	49.4	49.0	1.5
ERX1946834	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946835	pass	RSeQC	auto	unstranded	49.5	48.9	1.6
ERX1946835	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946836	pass	RSeQC	auto	unstranded	49.6	48.8	1.6
ERX1946836	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946837	pass	RSeQC	auto	unstranded	49.9	48.7	1.4
ERX1946837	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946838	pass	RSeQC	auto	unstranded	50.1	49.0	1.0
ERX1946838	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946839	pass	RSeQC	auto	unstranded	49.9	48.8	1.4
ERX1946839	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946840	pass	RSeQC	auto	unstranded	49.8	48.9	1.3
ERX1946840	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946841	pass	RSeQC	auto	unstranded	49.4	49.1	1.4
ERX1946841	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946842	pass	RSeQC	auto	unstranded	49.6	48.9	1.4
ERX1946842	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946843	pass	RSeQC	auto	unstranded	49.0	49.1	2.0
ERX1946843	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946844	pass	RSeQC	auto	unstranded	49.3	48.7	2.0
ERX1946844	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946845	pass	RSeQC	auto	unstranded	49.0	49.1	2.0
ERX1946845	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946846	pass	RSeQC	auto	unstranded	49.4	48.9	1.7
ERX1946846	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946847	pass	RSeQC	auto	unstranded	49.6	48.7	1.6
ERX1946847	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946848	pass	RSeQC	auto	unstranded	49.6	48.8	1.5
ERX1946848	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946849	pass	RSeQC	auto	unstranded	49.5	48.3	2.2
ERX1946849	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946850	pass	RSeQC	auto	unstranded	49.4	48.8	1.9
ERX1946850	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946851	pass	RSeQC	auto	unstranded	49.3	49.1	1.6
ERX1946851	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946852	pass	RSeQC	auto	unstranded	49.6	49.0	1.5
ERX1946852	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946853	pass	RSeQC	auto	unstranded	49.5	49.0	1.5
ERX1946853	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946854	pass	RSeQC	auto	unstranded	49.9	48.9	1.2
ERX1946854	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946855	pass	RSeQC	auto	unstranded	49.8	49.2	0.9
ERX1946855	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946856	pass	RSeQC	auto	unstranded	49.8	49.1	1.0
ERX1946856	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946857	pass	RSeQC	auto	unstranded	49.9	49.1	1.0
ERX1946857	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946858	pass	RSeQC	auto	unstranded	49.7	49.1	1.2
ERX1946858	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946859	pass	RSeQC	auto	unstranded	49.5	49.2	1.3
ERX1946859	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946860	pass	RSeQC	auto	unstranded	49.5	48.8	1.8
ERX1946860	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946861	pass	RSeQC	auto	unstranded	49.8	48.8	1.4
ERX1946861	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946862	pass	RSeQC	auto	unstranded	49.8	48.8	1.4
ERX1946862	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946863	pass	RSeQC	auto	unstranded	49.7	48.8	1.5
ERX1946863	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946864	pass	RSeQC	auto	unstranded	49.7	48.9	1.4
ERX1946864	pass	Salmon	auto	unstranded	50.6	49.4	0.0
ERX1946865	pass	RSeQC	auto	unstranded	49.7	49.0	1.3
ERX1946865	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946866	pass	RSeQC	auto	unstranded	49.5	48.9	1.5
ERX1946866	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946867	pass	RSeQC	auto	unstranded	49.5	49.0	1.5
ERX1946867	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946868	pass	RSeQC	auto	unstranded	49.4	48.9	1.7
ERX1946868	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946869	pass	RSeQC	auto	unstranded	49.3	48.8	1.9
ERX1946869	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946870	pass	RSeQC	auto	unstranded	49.4	48.8	1.7
ERX1946870	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946871	pass	RSeQC	auto	unstranded	49.4	48.9	1.7
ERX1946871	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946872	pass	RSeQC	auto	unstranded	49.4	48.8	1.9
ERX1946872	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946873	pass	RSeQC	auto	unstranded	49.6	48.8	1.6
ERX1946873	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946874	pass	RSeQC	auto	unstranded	49.2	49.2	1.6
ERX1946874	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946875	pass	RSeQC	auto	unstranded	49.2	49.0	1.8
ERX1946875	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946876	pass	RSeQC	auto	unstranded	49.2	48.9	1.8
ERX1946876	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946877	pass	RSeQC	auto	unstranded	49.3	48.8	1.9
ERX1946877	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946878	pass	RSeQC	auto	unstranded	49.0	49.3	1.7
ERX1946878	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946879	pass	RSeQC	auto	unstranded	49.9	48.6	1.5
ERX1946879	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946880	pass	RSeQC	auto	unstranded	49.7	48.9	1.3
ERX1946880	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946881	pass	RSeQC	auto	unstranded	49.7	49.4	0.9
ERX1946881	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946882	pass	RSeQC	auto	unstranded	50.2	48.6	1.3
ERX1946882	pass	Salmon	auto	unstranded	50.6	49.4	0.0
ERX1946883	pass	RSeQC	auto	unstranded	49.6	49.0	1.3
ERX1946883	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946884	pass	RSeQC	auto	unstranded	49.5	49.0	1.5
ERX1946884	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946885	pass	RSeQC	auto	unstranded	49.5	49.0	1.5
ERX1946885	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946886	pass	RSeQC	auto	unstranded	49.7	49.1	1.2
ERX1946886	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946887	pass	RSeQC	auto	unstranded	49.7	49.0	1.3
ERX1946887	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946888	pass	RSeQC	auto	unstranded	49.7	48.8	1.5
ERX1946888	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946889	pass	RSeQC	auto	unstranded	49.8	48.9	1.3
ERX1946889	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946890	pass	RSeQC	auto	unstranded	49.8	48.8	1.4
ERX1946890	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946891	pass	RSeQC	auto	unstranded	49.8	48.9	1.4
ERX1946891	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946892	pass	RSeQC	auto	unstranded	49.5	48.9	1.5
ERX1946892	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946893	pass	RSeQC	auto	unstranded	49.6	48.9	1.5
ERX1946893	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946894	pass	RSeQC	auto	unstranded	49.7	48.8	1.4
ERX1946894	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946895	pass	RSeQC	auto	unstranded	49.2	48.9	1.9
ERX1946895	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946896	pass	RSeQC	auto	unstranded	49.2	49.0	1.7
ERX1946896	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946897	pass	RSeQC	auto	unstranded	49.2	48.9	1.9
ERX1946897	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946898	pass	RSeQC	auto	unstranded	49.4	48.8	1.8
ERX1946898	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946899	pass	RSeQC	auto	unstranded	49.6	48.6	1.8
ERX1946899	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946900	pass	RSeQC	auto	unstranded	49.3	49.0	1.8
ERX1946900	pass	Salmon	auto	unstranded	50.1	49.9	0.0
ERX1946901	pass	RSeQC	auto	unstranded	49.2	49.0	1.8
ERX1946901	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946902	pass	RSeQC	auto	unstranded	49.7	48.6	1.8
ERX1946902	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946903	pass	RSeQC	auto	unstranded	49.6	48.7	1.7
ERX1946903	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946904	pass	RSeQC	auto	unstranded	49.8	48.6	1.6
ERX1946904	pass	Salmon	auto	unstranded	50.3	49.7	0.0
ERX1946905	pass	RSeQC	auto	unstranded	49.6	48.7	1.7
ERX1946905	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946906	pass	RSeQC	auto	unstranded	49.6	49.0	1.4
ERX1946906	pass	Salmon	auto	unstranded	50.5	49.5	0.0
ERX1946907	pass	RSeQC	auto	unstranded	49.8	49.2	1.0
ERX1946907	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946908	pass	RSeQC	auto	unstranded	49.9	49.2	1.0
ERX1946908	pass	Salmon	auto	unstranded	50.4	49.6	0.0
ERX1946909	pass	RSeQC	auto	unstranded	49.9	48.7	1.4
ERX1946909	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946910	pass	RSeQC	auto	unstranded	49.5	49.1	1.4
ERX1946910	pass	Salmon	auto	unstranded	50.2	49.8	0.0
ERX1946911	pass	RSeQC	auto	unstranded	50.0	48.6	1.4
ERX1946911	pass	Salmon	auto	unstranded	50.4	49.6	0.0

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fail_strand_check_table_table

Sort	Column	Description	ID
\|\|	Status	Pass if the strandedness inferred by RSeQC matches that provided by the user or predicted by Salmon. Fail otherwise.	`samples_strandedness_check-Status`
\|\|	Strand inference method	Tool used to detect strandedness	`samples_strandedness_check-Strand_inference_method`
\|\|	Provided strandedness	User-provided strandedness	`samples_strandedness_check-Provided_strandedness`
\|\|	Inferred strandedness	Interred strandedness	`samples_strandedness_check-Inferred_strandedness`
\|\|	Sense (%)	Sense (%)	`samples_strandedness_check-Sense`
\|\|	Antisense (%)	Antisense (%)	`samples_strandedness_check-Antisense`
\|\|	Unstranded (%)	Unstranded (%)	`samples_strandedness_check-Unstranded`

FastQC (raw)

This section of the report shows FastQC results before adapter trimming.URL: http://www.bioinformatics.babraham.ac.uk/projects/fastqc

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

All samples have sequences of a single length (83bp, 101bp) See the General Statistics Table.

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (e.g. PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

468 samples had less than 1% of reads made up of overrepresented sequences

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ⁰/₁ rows and ³/₃ columns.

Overrepresented sequence	Reports	Occurrences	% of all reads
GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC	3	104696	0.0011%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_raw_top_overrepresented_sequences_table_table

Sort	Column	Description	ID
\|\|	Reports	Number of FastQC reports where this sequence is founds as overrepresented	`fastqc_raw-samples`
\|\|	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`fastqc_raw-total_count`
\|\|	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`fastqc_raw-total_percent`

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

Cutadapt

Finds and removes adapter sequences, primers, poly-A tails, and other types of unwanted sequences.URL: https://cutadapt.readthedocs.ioDOI: 10.14806/ej.17.1.200

Filtered Reads

This plot shows the number of reads (SE) / pairs (PE) removed by Cutadapt.

Created with MultiQC

Trimmed Sequence Lengths (3')

This plot shows the number of reads with certain lengths of adapter trimmed for the 3' end.

Obs/Exp shows the raw counts divided by the number expected due to sequencing errors. A defined peak may be related to adapter length.

See the cutadapt documentation for more information on how these numbers are generated.

Created with MultiQC

FastQC (trimmed)

This section of the report shows FastQC results after adapter trimming.URL: http://www.bioinformatics.babraham.ac.uk/projects/fastqc

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (e.g. PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

468 samples had less than 1% of reads made up of overrepresented sequences

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ⁰/₀ rows.

Overrepresented sequence

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_trimmed_top_overrepresented_sequences_table_table

Sort	Visible	Group	Column	Description	ID	Scale

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

DupRadar

DupRadar provides duplication rate quality control for RNA-Seq datasets. Highly expressed genes can be expected to have a lot of duplicate reads, but high numbers of duplicates at low read counts can indicate low library complexity with technical duplication. This plot shows the general linear models - a summary of the gene duplication distributions.URL: bioconductor.org/packages/release/bioc/html/dupRadar.html

Created with MultiQC

Picard

Tools for manipulating high-throughput sequencing data.URL: http://broadinstitute.github.io/picard

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

QualiMap

Quality control of alignment data and its derivatives like feature counts.URL: http://qualimap.bioinfo.cipf.esDOI: 10.1093/bioinformatics/btv566; 10.1093/bioinformatics/bts503

Genomic origin of reads

Classification of mapped reads as originating in exonic, intronic or intergenic regions. These can be displayed as either the number or percentage of mapped reads.

There are currently three main approaches to map reads to transcripts in an RNA-seq experiment: mapping reads to a reference genome to identify expressed transcripts that are annotated (and discover those that are unknown), mapping reads to a reference transcriptome, and de novo assembly of transcript sequences (Conesa et al. 2016).

For RNA-seq QC analysis, QualiMap can be used to assess alignments produced by the first of these approaches. For input, it requires a GTF annotation file along with a reference genome, which can be used to reconstruct the exon structure of known transcripts. This allows mapped reads to be grouped by whether they originate in an exonic region (for QualiMap, this may include 5′ and 3′ UTR regions as well as protein-coding exons), an intron, or an intergenic region (see the Qualimap 2 documentation).

The inferred genomic origins of RNA-seq reads are presented here as a bar graph showing either the number or percentage of mapped reads in each read dataset that have been assigned to each type of genomic region. This graph can be used to assess the proportion of useful reads in an RNA-seq experiment. That proportion can be reduced by the presence of intron sequences, especially if depletion of ribosomal RNA was used during sample preparation (Sims et al. 2014). It can also be reduced by off-target transcripts, which are detected in greater numbers at the sequencing depths needed to detect poorly-expressed transcripts (Tarazona et al. 2011).

Created with MultiQC

Gene Coverage Profile

Mean distribution of coverage depth across the length of all mapped transcripts.

There are currently three main approaches to map reads to transcripts in an RNA-seq experiment: mapping reads to a reference genome to identify expressed transcripts that are annotated (and discover those that are unknown), mapping reads to a reference transcriptome, and de novo assembly of transcript sequences (Conesa et al. 2016).

For RNA-seq QC analysis, QualiMap can be used to assess alignments produced by the first of these approaches. For input, it requires a GTF annotation file along with a reference genome, which can be used to reconstruct the exon structure of known transcripts. QualiMap uses this information to calculate the depth of coverage along the length of each annotated transcript. For a set of reads mapped to a transcript, the depth of coverage at a given base position is the number of high-quality reads that map to the transcript at that position (Sims et al. 2014).

QualiMap calculates coverage depth at every base position of each annotated transcript. To enable meaningful comparison between transcripts, base positions are rescaled to relative positions expressed as percentage distance along each transcript (0%, 1%, …, 99%). For the set of transcripts with at least one mapped read, QualiMap plots the cumulative mapped-read depth (y-axis) at each relative transcript position (x-axis). This plot shows the gene coverage profile across all mapped transcripts for each read dataset. It provides a visual way to assess positional biases, such as an accumulation of mapped reads at the 3′ end of transcripts, which may indicate poor RNA quality in the original sample (Conesa et al. 2016).

The Normalised plot is calculated by MultiQC to enable comparison of samples with varying sequencing depth. The cumulative mapped-read depth at each position across the averaged transcript position are divided by the total for that sample across the entire averaged transcript.

Created with MultiQC

RSeQC

Evaluates high throughput RNA-seq data.URL: http://rseqc.sourceforge.netDOI: 10.1093/bioinformatics/bts356

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁰/₂₃₄ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
ERX1946678	40.1M	0.0M	5.2M	1.0M	0.0M	33.5M	16.8M	16.8M	16.8M	16.8M	22.9M	10.6M	33.5M	0.0M
ERX1946679	40.9M	0.0M	5.8M	1.2M	0.0M	33.4M	16.7M	16.7M	16.7M	16.7M	22.7M	10.7M	33.4M	0.0M
ERX1946680	38.2M	0.0M	5.9M	1.2M	0.0M	30.6M	15.3M	15.3M	15.3M	15.3M	20.7M	9.9M	30.6M	0.0M
ERX1946681	30.8M	0.0M	4.8M	0.8M	0.0M	24.8M	12.4M	12.4M	12.4M	12.4M	16.9M	8.0M	24.8M	0.0M
ERX1946682	36.9M	0.0M	6.9M	1.1M	0.0M	28.4M	14.2M	14.2M	14.2M	14.2M	19.5M	8.9M	28.4M	0.0M
ERX1946683	32.6M	0.0M	6.0M	0.9M	0.0M	25.3M	12.7M	12.7M	12.7M	12.7M	17.5M	7.8M	25.3M	0.0M
ERX1946684	49.0M	0.0M	10.0M	1.4M	0.0M	37.0M	18.5M	18.5M	18.5M	18.5M	25.6M	11.4M	37.0M	0.0M
ERX1946685	32.7M	0.0M	5.1M	0.9M	0.0M	26.3M	13.1M	13.1M	13.1M	13.1M	18.0M	8.3M	26.3M	0.0M
ERX1946686	33.3M	0.0M	4.9M	0.9M	0.0M	27.1M	13.5M	13.5M	13.5M	13.5M	18.4M	8.7M	27.1M	0.0M
ERX1946687	33.7M	0.0M	4.8M	1.3M	0.0M	26.9M	13.5M	13.5M	13.5M	13.5M	18.6M	8.3M	26.9M	0.0M
ERX1946688	35.4M	0.0M	4.4M	0.8M	0.0M	29.7M	14.9M	14.9M	14.9M	14.9M	20.5M	9.2M	29.7M	0.0M
ERX1946689	37.6M	0.0M	5.1M	0.9M	0.0M	31.2M	15.6M	15.6M	15.6M	15.6M	21.5M	9.7M	31.2M	0.0M
ERX1946690	33.7M	0.0M	5.2M	0.7M	0.0M	27.5M	13.7M	13.7M	13.7M	13.7M	19.1M	8.3M	27.5M	0.0M
ERX1946691	37.8M	0.0M	6.0M	1.1M	0.0M	30.2M	15.1M	15.1M	15.1M	15.1M	20.9M	9.3M	30.2M	0.0M
ERX1946692	41.8M	0.0M	7.1M	1.9M	0.0M	32.0M	16.0M	16.0M	16.0M	16.0M	22.3M	9.7M	32.0M	0.0M
ERX1946693	36.2M	0.0M	6.0M	1.1M	0.0M	28.5M	14.2M	14.2M	14.2M	14.2M	19.7M	8.8M	28.5M	0.0M
ERX1946694	50.4M	0.0M	9.3M	1.4M	0.0M	39.0M	19.5M	19.5M	19.5M	19.5M	26.7M	12.3M	39.0M	0.0M
ERX1946695	46.3M	0.0M	7.2M	1.0M	0.0M	37.7M	18.9M	18.9M	18.9M	18.9M	25.8M	11.9M	37.7M	0.0M
ERX1946696	36.2M	0.0M	4.7M	0.8M	0.0M	30.3M	15.1M	15.1M	15.1M	15.1M	20.8M	9.5M	30.2M	0.0M
ERX1946697	37.4M	0.0M	5.4M	0.9M	0.0M	30.6M	15.3M	15.3M	15.3M	15.3M	20.9M	9.7M	30.6M	0.0M
ERX1946698	42.5M	0.0M	7.1M	1.0M	0.0M	33.9M	17.0M	17.0M	17.0M	17.0M	23.0M	10.9M	33.9M	0.0M
ERX1946699	37.2M	0.0M	5.6M	0.9M	0.0M	30.3M	15.2M	15.2M	15.2M	15.2M	20.9M	9.4M	30.3M	0.0M
ERX1946700	43.0M	0.0M	6.9M	1.0M	0.0M	34.6M	17.3M	17.3M	17.3M	17.3M	23.8M	10.8M	34.6M	0.0M
ERX1946701	48.7M	0.0M	9.0M	1.3M	0.0M	37.8M	18.9M	18.9M	18.9M	18.9M	25.9M	12.0M	37.8M	0.0M
ERX1946702	43.1M	0.0M	7.6M	1.0M	0.0M	34.0M	17.0M	17.0M	17.0M	17.0M	23.2M	10.8M	34.0M	0.0M
ERX1946703	42.4M	0.0M	6.9M	1.0M	0.0M	34.0M	17.0M	17.0M	17.0M	17.0M	23.5M	10.5M	34.0M	0.0M
ERX1946704	40.9M	0.0M	6.5M	1.2M	0.0M	32.7M	16.4M	16.4M	16.4M	16.4M	22.0M	10.7M	32.7M	0.0M
ERX1946705	40.2M	0.0M	5.3M	1.2M	0.0M	33.3M	16.6M	16.6M	16.6M	16.6M	22.4M	10.9M	33.3M	0.0M
ERX1946706	33.5M	0.0M	4.5M	0.9M	0.0M	27.7M	13.8M	13.8M	13.8M	13.8M	18.6M	9.1M	27.7M	0.0M
ERX1946707	36.4M	0.0M	5.8M	1.0M	0.0M	29.3M	14.6M	14.6M	14.6M	14.6M	19.7M	9.6M	29.3M	0.0M
ERX1946708	36.5M	0.0M	6.5M	1.0M	0.0M	28.5M	14.3M	14.3M	14.3M	14.3M	19.4M	9.1M	28.5M	0.0M
ERX1946709	38.8M	0.0M	8.3M	1.1M	0.0M	29.0M	14.5M	14.5M	14.5M	14.5M	19.8M	9.2M	29.0M	0.0M
ERX1946710	33.0M	0.0M	6.0M	0.9M	0.0M	25.7M	12.8M	12.8M	12.8M	12.8M	17.5M	8.2M	25.7M	0.0M
ERX1946711	38.2M	0.0M	6.8M	1.1M	0.0M	29.8M	14.9M	14.9M	14.9M	14.9M	20.2M	9.6M	29.8M	0.0M
ERX1946712	34.8M	0.0M	4.8M	0.9M	0.0M	28.7M	14.4M	14.4M	14.4M	14.4M	19.3M	9.4M	28.7M	0.0M
ERX1946713	46.5M	0.0M	6.7M	1.2M	0.0M	38.0M	19.0M	19.0M	19.0M	19.0M	25.9M	12.1M	38.0M	0.0M
ERX1946714	41.1M	0.0M	5.8M	1.1M	0.0M	33.7M	16.9M	16.9M	16.9M	16.9M	23.1M	10.7M	33.7M	0.0M
ERX1946715	39.5M	0.0M	5.2M	0.9M	0.0M	32.9M	16.5M	16.5M	16.5M	16.5M	22.6M	10.4M	32.9M	0.0M
ERX1946716	43.6M	0.0M	6.8M	1.0M	0.0M	35.3M	17.7M	17.7M	17.7M	17.7M	24.3M	11.0M	35.3M	0.0M
ERX1946717	39.4M	0.0M	6.3M	0.9M	0.0M	31.7M	15.8M	15.8M	15.8M	15.8M	21.7M	10.0M	31.7M	0.0M
ERX1946718	43.5M	0.0M	7.0M	1.0M	0.0M	35.0M	17.5M	17.5M	17.5M	17.5M	23.8M	11.3M	35.0M	0.0M
ERX1946719	50.8M	0.0M	8.7M	1.1M	0.0M	40.5M	20.2M	20.2M	20.2M	20.2M	27.5M	13.0M	40.5M	0.0M
ERX1946720	40.3M	0.0M	6.4M	0.9M	0.0M	32.5M	16.3M	16.3M	16.3M	16.3M	22.0M	10.5M	32.5M	0.0M
ERX1946721	36.8M	0.0M	5.8M	0.9M	0.0M	29.6M	14.8M	14.8M	14.8M	14.8M	19.8M	9.8M	29.6M	0.0M
ERX1946722	36.4M	0.0M	5.5M	0.9M	0.0M	29.6M	14.8M	14.8M	14.8M	14.8M	20.0M	9.6M	29.6M	0.0M
ERX1946723	41.6M	0.0M	6.6M	1.1M	0.0M	33.4M	16.7M	16.7M	16.7M	16.7M	22.5M	10.9M	33.4M	0.0M
ERX1946724	43.5M	0.0M	7.5M	1.1M	0.0M	34.3M	17.2M	17.2M	17.2M	17.2M	23.1M	11.3M	34.3M	0.0M
ERX1946725	41.4M	0.0M	6.9M	1.1M	0.0M	33.0M	16.5M	16.5M	16.5M	16.5M	22.2M	10.8M	33.0M	0.0M
ERX1946726	46.4M	0.0M	8.5M	1.3M	0.0M	35.9M	18.0M	18.0M	18.0M	18.0M	24.1M	11.8M	35.9M	0.0M
ERX1946727	50.4M	0.0M	9.9M	1.4M	0.0M	38.5M	19.3M	19.3M	19.3M	19.3M	25.8M	12.7M	38.5M	0.0M
ERX1946728	42.4M	0.0M	7.6M	1.3M	0.0M	32.9M	16.5M	16.5M	16.5M	16.5M	22.1M	10.8M	32.9M	0.0M
ERX1946729	38.2M	0.0M	6.4M	1.0M	0.0M	30.3M	15.2M	15.2M	15.2M	15.2M	20.3M	10.0M	30.3M	0.0M
ERX1946730	43.4M	0.0M	6.8M	1.2M	0.0M	34.9M	17.5M	17.5M	17.5M	17.5M	23.5M	11.5M	34.9M	0.0M
ERX1946731	39.6M	0.0M	5.4M	1.1M	0.0M	32.6M	16.3M	16.3M	16.3M	16.3M	21.9M	10.6M	32.6M	0.0M
ERX1946732	42.7M	0.0M	6.9M	1.3M	0.0M	34.0M	17.0M	17.0M	17.0M	17.0M	22.8M	11.2M	34.0M	0.0M
ERX1946733	43.9M	0.0M	7.7M	1.2M	0.0M	34.5M	17.2M	17.2M	17.2M	17.2M	23.2M	11.3M	34.5M	0.0M
ERX1946734	47.5M	0.0M	10.2M	1.5M	0.0M	35.2M	17.6M	17.6M	17.6M	17.6M	23.9M	11.3M	35.2M	0.0M
ERX1946735	43.1M	0.0M	9.5M	1.3M	0.0M	31.8M	15.9M	15.9M	15.9M	15.9M	21.7M	10.1M	31.8M	0.0M
ERX1946736	41.7M	0.0M	8.5M	1.2M	0.0M	31.6M	15.8M	15.8M	15.8M	15.8M	21.5M	10.1M	31.6M	0.0M
ERX1946737	37.3M	0.0M	6.4M	1.0M	0.0M	29.5M	14.7M	14.7M	14.7M	14.7M	20.0M	9.5M	29.5M	0.0M
ERX1946738	35.7M	0.0M	5.3M	0.9M	0.0M	29.1M	14.5M	14.5M	14.5M	14.5M	19.5M	9.5M	29.1M	0.0M
ERX1946739	42.4M	0.0M	5.4M	1.1M	0.0M	35.3M	17.7M	17.7M	17.7M	17.7M	24.3M	11.1M	35.3M	0.0M
ERX1946740	51.3M	0.0M	7.9M	1.4M	0.0M	41.4M	20.7M	20.7M	20.7M	20.7M	28.5M	13.0M	41.4M	0.0M
ERX1946741	47.6M	0.0M	8.2M	1.1M	0.0M	37.8M	18.9M	18.9M	18.9M	18.9M	25.9M	11.8M	37.8M	0.0M
ERX1946742	53.1M	0.0M	8.3M	1.3M	0.0M	43.0M	21.5M	21.5M	21.5M	21.5M	29.6M	13.4M	43.0M	0.0M
ERX1946743	49.1M	0.0M	8.8M	1.2M	0.0M	38.5M	19.2M	19.2M	19.2M	19.2M	26.3M	12.2M	38.5M	0.0M
ERX1946744	47.1M	0.0M	8.0M	1.1M	0.0M	37.5M	18.7M	18.7M	18.7M	18.7M	25.5M	12.0M	37.5M	0.0M
ERX1946745	43.2M	0.0M	6.9M	1.0M	0.0M	34.8M	17.4M	17.4M	17.4M	17.4M	23.5M	11.3M	34.8M	0.0M
ERX1946746	42.4M	0.0M	6.2M	0.9M	0.0M	34.8M	17.4M	17.4M	17.4M	17.4M	23.5M	11.3M	34.8M	0.0M
ERX1946747	33.7M	0.0M	9.2M	0.8M	0.0M	23.3M	11.6M	11.6M	11.6M	11.6M	15.1M	8.2M	23.3M	0.0M
ERX1946748	33.6M	0.0M	9.1M	0.8M	0.0M	23.2M	11.6M	11.6M	11.6M	11.6M	15.1M	8.2M	23.2M	0.0M
ERX1946749	34.1M	0.0M	9.3M	0.9M	0.0M	23.5M	11.7M	11.7M	11.7M	11.7M	15.2M	8.2M	23.5M	0.0M
ERX1946750	33.8M	0.0M	5.2M	0.8M	0.0M	27.4M	13.7M	13.7M	13.7M	13.7M	17.7M	9.7M	27.4M	0.0M
ERX1946751	33.7M	0.0M	5.2M	0.8M	0.0M	27.3M	13.7M	13.7M	13.7M	13.7M	17.7M	9.7M	27.3M	0.0M
ERX1946752	34.2M	0.0M	5.3M	0.8M	0.0M	27.7M	13.9M	13.9M	13.9M	13.9M	17.9M	9.8M	27.7M	0.0M
ERX1946753	45.7M	0.0M	7.6M	1.1M	0.0M	36.5M	18.2M	18.2M	18.2M	18.2M	23.7M	12.8M	36.5M	0.0M
ERX1946754	45.5M	0.0M	7.5M	1.1M	0.0M	36.3M	18.2M	18.2M	18.2M	18.2M	23.6M	12.8M	36.3M	0.0M
ERX1946755	46.1M	0.0M	7.7M	1.2M	0.0M	36.8M	18.4M	18.4M	18.4M	18.4M	23.9M	12.9M	36.8M	0.0M
ERX1946756	50.4M	0.0M	9.3M	1.3M	0.0M	39.2M	19.6M	19.6M	19.6M	19.6M	25.3M	13.8M	39.2M	0.0M
ERX1946757	50.2M	0.0M	9.3M	1.3M	0.0M	39.0M	19.5M	19.5M	19.5M	19.5M	25.3M	13.8M	39.0M	0.0M
ERX1946758	50.8M	0.0M	9.5M	1.3M	0.0M	39.5M	19.7M	19.7M	19.7M	19.7M	25.5M	13.9M	39.5M	0.0M
ERX1946759	45.5M	0.0M	8.1M	1.2M	0.0M	35.6M	17.8M	17.8M	17.8M	17.8M	23.0M	12.6M	35.6M	0.0M
ERX1946760	45.4M	0.0M	8.1M	1.2M	0.0M	35.5M	17.8M	17.8M	17.8M	17.8M	22.9M	12.6M	35.5M	0.0M
ERX1946761	46.0M	0.0M	8.3M	1.2M	0.0M	36.0M	18.0M	18.0M	18.0M	18.0M	23.3M	12.7M	36.0M	0.0M
ERX1946762	34.1M	0.0M	6.2M	0.9M	0.0M	26.6M	13.3M	13.3M	13.3M	13.3M	17.1M	9.5M	26.6M	0.0M
ERX1946763	34.0M	0.0M	6.1M	0.9M	0.0M	26.5M	13.3M	13.3M	13.3M	13.3M	17.1M	9.4M	26.5M	0.0M
ERX1946764	34.4M	0.0M	6.3M	0.9M	0.0M	26.8M	13.4M	13.4M	13.4M	13.4M	17.3M	9.6M	26.8M	0.0M
ERX1946765	35.4M	0.0M	5.4M	0.9M	0.0M	28.7M	14.3M	14.3M	14.3M	14.3M	19.2M	9.4M	28.7M	0.0M
ERX1946766	35.3M	0.0M	5.4M	0.9M	0.0M	28.6M	14.3M	14.3M	14.3M	14.3M	19.2M	9.4M	28.6M	0.0M
ERX1946767	35.6M	0.0M	5.5M	0.9M	0.0M	28.8M	14.4M	14.4M	14.4M	14.4M	19.3M	9.5M	28.8M	0.0M
ERX1946768	44.2M	0.0M	8.0M	1.2M	0.0M	34.5M	17.3M	17.2M	17.3M	17.3M	22.6M	11.9M	34.5M	0.0M
ERX1946769	44.0M	0.0M	8.0M	1.1M	0.0M	34.4M	17.2M	17.2M	17.2M	17.2M	22.5M	11.9M	34.4M	0.0M
ERX1946770	44.7M	0.0M	8.2M	1.2M	0.0M	34.8M	17.4M	17.4M	17.4M	17.4M	22.8M	12.0M	34.8M	0.0M
ERX1946771	57.6M	0.0M	11.3M	2.0M	0.0M	43.3M	21.6M	21.6M	21.6M	21.6M	28.2M	15.1M	43.3M	0.0M
ERX1946772	57.5M	0.0M	11.2M	2.1M	0.0M	43.1M	21.6M	21.6M	21.6M	21.6M	28.1M	15.0M	43.1M	0.0M
ERX1946773	58.1M	0.0M	11.5M	2.1M	0.0M	43.6M	21.8M	21.8M	21.8M	21.8M	28.4M	15.2M	43.6M	0.0M
ERX1946774	37.6M	0.0M	4.7M	0.9M	0.0M	31.6M	15.8M	15.8M	15.8M	15.8M	21.0M	10.6M	31.6M	0.0M
ERX1946775	38.2M	0.0M	5.2M	1.0M	0.0M	31.4M	15.7M	15.7M	15.7M	15.7M	20.7M	10.7M	31.4M	0.0M
ERX1946776	35.9M	0.0M	5.4M	1.1M	0.0M	28.9M	14.5M	14.5M	14.5M	14.5M	19.0M	9.9M	28.9M	0.0M
ERX1946777	29.0M	0.0M	4.3M	0.8M	0.0M	23.5M	11.7M	11.7M	11.7M	11.7M	15.5M	8.0M	23.5M	0.0M
ERX1946778	34.6M	0.0M	6.3M	1.0M	0.0M	26.9M	13.4M	13.4M	13.4M	13.4M	17.9M	9.0M	26.9M	0.0M
ERX1946779	30.4M	0.0M	5.5M	0.8M	0.0M	23.8M	11.9M	11.9M	11.9M	11.9M	16.0M	7.8M	23.8M	0.0M
ERX1946780	45.9M	0.0M	9.2M	1.3M	0.0M	34.9M	17.5M	17.5M	17.5M	17.5M	23.5M	11.5M	34.9M	0.0M
ERX1946781	30.6M	0.0M	4.7M	0.8M	0.0M	24.8M	12.4M	12.4M	12.4M	12.4M	16.5M	8.3M	24.8M	0.0M
ERX1946782	31.1M	0.0M	4.4M	0.8M	0.0M	25.5M	12.7M	12.7M	12.7M	12.7M	16.8M	8.7M	25.5M	0.0M
ERX1946783	32.0M	0.0M	4.4M	1.2M	0.0M	25.7M	12.9M	12.9M	12.9M	12.9M	17.2M	8.5M	25.7M	0.0M
ERX1946784	33.4M	0.0M	4.1M	0.7M	0.0M	28.2M	14.1M	14.1M	14.1M	14.1M	18.9M	9.4M	28.2M	0.0M
ERX1946785	35.5M	0.0M	4.7M	0.8M	0.0M	29.6M	14.8M	14.8M	14.8M	14.8M	19.7M	9.9M	29.6M	0.0M
ERX1946786	31.6M	0.0M	4.7M	0.6M	0.0M	26.0M	13.0M	13.0M	13.0M	13.0M	17.6M	8.4M	26.0M	0.0M
ERX1946787	35.8M	0.0M	5.5M	1.0M	0.0M	28.7M	14.4M	14.4M	14.4M	14.4M	19.4M	9.4M	28.7M	0.0M
ERX1946788	39.4M	0.0M	6.6M	1.7M	0.0M	30.4M	15.2M	15.2M	15.2M	15.2M	20.6M	9.8M	30.4M	0.0M
ERX1946789	34.3M	0.0M	5.5M	1.1M	0.0M	27.2M	13.6M	13.6M	13.6M	13.6M	18.2M	9.0M	27.2M	0.0M
ERX1946790	48.0M	0.0M	8.7M	1.3M	0.0M	37.4M	18.7M	18.7M	18.7M	18.7M	24.8M	12.6M	37.4M	0.0M
ERX1946791	43.9M	0.0M	6.6M	0.9M	0.0M	35.9M	18.0M	18.0M	18.0M	18.0M	23.9M	12.0M	35.9M	0.0M
ERX1946792	34.4M	0.0M	4.3M	0.7M	0.0M	28.9M	14.4M	14.4M	14.4M	14.4M	19.3M	9.6M	28.9M	0.0M
ERX1946793	35.7M	0.0M	5.1M	0.8M	0.0M	29.3M	14.7M	14.7M	14.7M	14.7M	19.5M	9.8M	29.3M	0.0M
ERX1946794	40.4M	0.0M	6.6M	0.9M	0.0M	32.5M	16.2M	16.2M	16.2M	16.2M	21.4M	11.0M	32.5M	0.0M
ERX1946795	35.5M	0.0M	5.2M	0.9M	0.0M	29.0M	14.5M	14.5M	14.5M	14.5M	19.5M	9.6M	29.0M	0.0M
ERX1946796	41.1M	0.0M	6.5M	0.9M	0.0M	33.2M	16.6M	16.6M	16.6M	16.6M	22.3M	11.0M	33.2M	0.0M
ERX1946797	46.7M	0.0M	8.5M	1.2M	0.0M	36.5M	18.3M	18.3M	18.3M	18.3M	24.3M	12.2M	36.5M	0.0M
ERX1946798	41.2M	0.0M	7.1M	0.9M	0.0M	32.7M	16.4M	16.4M	16.4M	16.4M	21.7M	11.0M	32.7M	0.0M
ERX1946799	40.3M	0.0M	6.4M	0.9M	0.0M	32.5M	16.3M	16.3M	16.3M	16.3M	21.9M	10.7M	32.5M	0.0M
ERX1946800	40.6M	0.0M	6.4M	1.1M	0.0M	32.6M	16.3M	16.3M	16.3M	16.3M	21.5M	11.1M	32.6M	0.0M
ERX1946801	39.0M	0.0M	5.0M	1.2M	0.0M	32.3M	16.2M	16.2M	16.2M	16.2M	21.3M	11.0M	32.3M	0.0M
ERX1946802	33.1M	0.0M	4.4M	0.9M	0.0M	27.3M	13.7M	13.7M	13.7M	13.7M	18.0M	9.3M	27.3M	0.0M
ERX1946803	35.0M	0.0M	5.5M	0.9M	0.0M	28.3M	14.1M	14.1M	14.1M	14.1M	18.6M	9.6M	28.3M	0.0M
ERX1946804	36.3M	0.0M	6.5M	1.0M	0.0M	28.4M	14.2M	14.2M	14.2M	14.2M	18.9M	9.5M	28.4M	0.0M
ERX1946805	38.4M	0.0M	8.1M	1.1M	0.0M	28.7M	14.4M	14.4M	14.4M	14.4M	19.2M	9.5M	28.7M	0.0M
ERX1946806	32.3M	0.0M	5.9M	0.8M	0.0M	25.2M	12.6M	12.6M	12.6M	12.6M	16.8M	8.4M	25.2M	0.0M
ERX1946807	38.1M	0.0M	6.8M	1.1M	0.0M	29.7M	14.9M	14.9M	14.9M	14.9M	19.7M	10.0M	29.7M	0.0M
ERX1946808	35.1M	0.0M	4.9M	0.9M	0.0M	28.9M	14.5M	14.5M	14.5M	14.5M	19.0M	9.9M	28.9M	0.0M
ERX1946809	45.2M	0.0M	6.4M	1.2M	0.0M	37.1M	18.5M	18.5M	18.5M	18.5M	24.6M	12.5M	37.1M	0.0M
ERX1946810	38.9M	0.0M	5.3M	1.0M	0.0M	32.1M	16.1M	16.1M	16.1M	16.1M	21.4M	10.7M	32.1M	0.0M
ERX1946811	38.4M	0.0M	5.0M	0.9M	0.0M	32.0M	16.0M	16.0M	16.0M	16.0M	21.4M	10.7M	32.0M	0.0M
ERX1946812	42.5M	0.0M	6.5M	1.0M	0.0M	34.6M	17.3M	17.3M	17.3M	17.3M	23.1M	11.4M	34.6M	0.0M
ERX1946813	38.5M	0.0M	6.0M	0.9M	0.0M	31.1M	15.5M	15.5M	15.5M	15.5M	20.7M	10.3M	31.1M	0.0M
ERX1946814	42.6M	0.0M	6.8M	0.9M	0.0M	34.4M	17.2M	17.2M	17.2M	17.2M	22.7M	11.7M	34.4M	0.0M
ERX1946815	50.1M	0.0M	8.5M	1.1M	0.0M	40.0M	20.0M	20.0M	20.0M	20.0M	26.4M	13.6M	40.0M	0.0M
ERX1946816	39.4M	0.0M	6.2M	0.9M	0.0M	31.9M	16.0M	16.0M	16.0M	16.0M	21.0M	10.9M	31.9M	0.0M
ERX1946817	35.0M	0.0M	5.4M	0.9M	0.0M	28.3M	14.1M	14.1M	14.1M	14.1M	18.3M	10.0M	28.3M	0.0M
ERX1946818	34.6M	0.0M	5.1M	0.8M	0.0M	28.3M	14.1M	14.1M	14.1M	14.1M	18.5M	9.8M	28.3M	0.0M
ERX1946819	39.4M	0.0M	6.1M	1.0M	0.0M	31.8M	15.9M	15.9M	15.9M	15.9M	20.8M	11.1M	31.8M	0.0M
ERX1946820	40.8M	0.0M	6.9M	1.0M	0.0M	32.4M	16.2M	16.2M	16.2M	16.2M	21.1M	11.3M	32.4M	0.0M
ERX1946821	39.1M	0.0M	6.3M	1.0M	0.0M	31.4M	15.7M	15.7M	15.7M	15.7M	20.4M	10.9M	31.3M	0.0M
ERX1946822	44.0M	0.0M	7.9M	1.2M	0.0M	34.3M	17.2M	17.2M	17.2M	17.2M	22.3M	12.0M	34.3M	0.0M
ERX1946823	47.7M	0.0M	9.1M	1.3M	0.0M	36.7M	18.3M	18.3M	18.3M	18.3M	23.8M	12.9M	36.7M	0.0M
ERX1946824	40.2M	0.0M	7.1M	1.1M	0.0M	31.4M	15.7M	15.7M	15.7M	15.7M	20.4M	11.0M	31.4M	0.0M
ERX1946825	36.3M	0.0M	6.0M	0.9M	0.0M	29.0M	14.5M	14.5M	14.5M	14.5M	18.8M	10.2M	29.0M	0.0M
ERX1946826	41.3M	0.0M	6.3M	1.1M	0.0M	33.5M	16.7M	16.7M	16.7M	16.7M	21.8M	11.7M	33.5M	0.0M
ERX1946827	37.2M	0.0M	4.9M	1.0M	0.0M	30.9M	15.4M	15.4M	15.4M	15.4M	20.1M	10.7M	30.9M	0.0M
ERX1946828	40.8M	0.0M	6.5M	1.2M	0.0M	32.7M	16.3M	16.3M	16.3M	16.3M	21.2M	11.5M	32.7M	0.0M
ERX1946829	41.9M	0.0M	7.2M	1.1M	0.0M	33.1M	16.6M	16.6M	16.6M	16.6M	21.5M	11.6M	33.1M	0.0M
ERX1946830	45.4M	0.0M	9.7M	1.3M	0.0M	33.9M	17.0M	17.0M	17.0M	17.0M	22.3M	11.6M	33.9M	0.0M
ERX1946831	41.3M	0.0M	9.0M	1.2M	0.0M	30.7M	15.3M	15.3M	15.3M	15.3M	20.3M	10.4M	30.7M	0.0M
ERX1946832	40.3M	0.0M	8.1M	1.1M	0.0M	30.6M	15.3M	15.3M	15.3M	15.3M	20.2M	10.4M	30.6M	0.0M
ERX1946833	35.9M	0.0M	6.0M	0.9M	0.0M	28.5M	14.2M	14.2M	14.2M	14.2M	18.7M	9.8M	28.5M	0.0M
ERX1946834	34.0M	0.0M	5.0M	0.8M	0.0M	27.8M	13.9M	13.9M	13.9M	13.9M	18.1M	9.7M	27.8M	0.0M
ERX1946835	41.2M	0.0M	5.2M	1.1M	0.0M	34.4M	17.2M	17.2M	17.2M	17.2M	23.0M	11.4M	34.4M	0.0M
ERX1946836	49.5M	0.0M	7.5M	1.3M	0.0M	40.2M	20.1M	20.1M	20.1M	20.1M	26.8M	13.4M	40.2M	0.0M
ERX1946837	46.1M	0.0M	7.8M	1.1M	0.0M	36.7M	18.4M	18.4M	18.4M	18.4M	24.5M	12.2M	36.7M	0.0M
ERX1946838	51.2M	0.0M	7.9M	1.2M	0.0M	41.6M	20.8M	20.8M	20.8M	20.8M	27.8M	13.8M	41.6M	0.0M
ERX1946839	47.3M	0.0M	8.3M	1.2M	0.0M	37.3M	18.7M	18.7M	18.7M	18.7M	24.7M	12.6M	37.3M	0.0M
ERX1946840	45.6M	0.0M	7.6M	1.0M	0.0M	36.4M	18.2M	18.2M	18.2M	18.2M	24.1M	12.4M	36.4M	0.0M
ERX1946841	41.5M	0.0M	6.5M	0.9M	0.0M	33.6M	16.8M	16.8M	16.8M	16.8M	22.0M	11.6M	33.6M	0.0M
ERX1946842	40.9M	0.0M	5.9M	0.9M	0.0M	33.6M	16.8M	16.8M	16.8M	16.8M	22.1M	11.6M	33.6M	0.0M
ERX1946843	42.2M	0.0M	5.6M	1.0M	0.0M	35.1M	17.5M	17.5M	17.5M	17.5M	23.1M	11.9M	35.1M	0.0M
ERX1946844	41.1M	0.0M	5.9M	1.2M	0.0M	33.6M	16.8M	16.8M	16.8M	16.8M	22.0M	11.6M	33.6M	0.0M
ERX1946845	40.1M	0.0M	6.4M	1.2M	0.0M	32.0M	16.0M	16.0M	16.0M	16.0M	20.9M	11.1M	32.0M	0.0M
ERX1946846	33.0M	0.0M	5.3M	0.9M	0.0M	26.4M	13.2M	13.2M	13.2M	13.2M	17.3M	9.1M	26.4M	0.0M
ERX1946847	39.3M	0.0M	7.6M	1.1M	0.0M	30.1M	15.0M	15.0M	15.0M	15.0M	19.9M	10.2M	30.1M	0.0M
ERX1946848	34.7M	0.0M	6.7M	0.9M	0.0M	26.7M	13.4M	13.4M	13.4M	13.4M	17.9M	8.8M	26.7M	0.0M
ERX1946849	52.1M	0.0M	11.0M	1.5M	0.0M	39.0M	19.5M	19.5M	19.5M	19.5M	26.0M	13.0M	39.0M	0.0M
ERX1946850	35.2M	0.0M	5.7M	1.0M	0.0M	28.0M	14.0M	14.0M	14.0M	14.0M	18.5M	9.5M	28.0M	0.0M
ERX1946851	34.9M	0.0M	5.3M	0.9M	0.0M	28.3M	14.1M	14.1M	14.1M	14.1M	18.6M	9.7M	28.3M	0.0M
ERX1946852	36.3M	0.0M	5.4M	1.4M	0.0M	28.8M	14.4M	14.4M	14.4M	14.4M	19.2M	9.6M	28.8M	0.0M
ERX1946853	37.7M	0.0M	4.9M	0.8M	0.0M	31.6M	15.8M	15.8M	15.8M	15.8M	21.0M	10.5M	31.6M	0.0M
ERX1946854	40.5M	0.0M	5.8M	0.9M	0.0M	33.4M	16.7M	16.7M	16.7M	16.7M	22.2M	11.2M	33.4M	0.0M
ERX1946855	36.1M	0.0M	5.8M	0.7M	0.0M	29.2M	14.6M	14.6M	14.6M	14.6M	19.7M	9.5M	29.2M	0.0M
ERX1946856	41.7M	0.0M	6.9M	1.2M	0.0M	32.9M	16.5M	16.5M	16.5M	16.5M	22.1M	10.8M	32.9M	0.0M
ERX1946857	44.6M	0.0M	7.9M	2.0M	0.0M	33.8M	16.9M	16.9M	16.9M	16.9M	22.8M	11.0M	33.8M	0.0M
ERX1946858	39.2M	0.0M	6.7M	1.2M	0.0M	30.6M	15.3M	15.3M	15.3M	15.3M	20.4M	10.2M	30.6M	0.0M
ERX1946859	55.7M	0.0M	10.8M	1.5M	0.0M	42.6M	21.3M	21.3M	21.3M	21.3M	28.1M	14.5M	42.6M	0.0M
ERX1946860	45.2M	0.0M	6.9M	0.9M	0.0M	37.0M	18.5M	18.5M	18.5M	18.5M	24.4M	12.6M	36.9M	0.0M
ERX1946861	35.1M	0.0M	4.5M	0.8M	0.0M	29.5M	14.7M	14.7M	14.7M	14.7M	19.5M	9.9M	29.5M	0.0M
ERX1946862	36.6M	0.0M	5.3M	0.8M	0.0M	30.1M	15.1M	15.1M	15.1M	15.1M	19.9M	10.2M	30.1M	0.0M
ERX1946863	41.8M	0.0M	6.9M	0.9M	0.0M	33.5M	16.8M	16.8M	16.8M	16.8M	21.9M	11.6M	33.5M	0.0M
ERX1946864	36.7M	0.0M	5.5M	0.8M	0.0M	29.9M	15.0M	15.0M	15.0M	15.0M	19.9M	10.0M	29.9M	0.0M
ERX1946865	42.3M	0.0M	6.7M	0.9M	0.0M	34.1M	17.1M	17.1M	17.1M	17.1M	22.7M	11.4M	34.1M	0.0M
ERX1946866	47.7M	0.0M	8.7M	1.2M	0.0M	37.2M	18.6M	18.6M	18.6M	18.6M	24.5M	12.7M	37.2M	0.0M
ERX1946867	42.2M	0.0M	7.4M	0.9M	0.0M	33.4M	16.7M	16.7M	16.7M	16.7M	22.0M	11.4M	33.4M	0.0M
ERX1946868	41.4M	0.0M	6.7M	0.9M	0.0M	33.4M	16.7M	16.7M	16.7M	16.7M	22.3M	11.1M	33.4M	0.0M
ERX1946869	44.6M	0.0M	7.4M	1.2M	0.0M	35.4M	17.7M	17.7M	17.7M	17.7M	23.0M	12.4M	35.4M	0.0M
ERX1946870	42.7M	0.0M	5.8M	1.2M	0.0M	35.1M	17.6M	17.6M	17.6M	17.6M	22.8M	12.3M	35.1M	0.0M
ERX1946871	36.3M	0.0M	5.1M	1.0M	0.0M	29.7M	14.9M	14.9M	14.9M	14.9M	19.3M	10.5M	29.7M	0.0M
ERX1946872	38.9M	0.0M	6.4M	1.1M	0.0M	31.0M	15.5M	15.5M	15.5M	15.5M	20.2M	10.8M	31.0M	0.0M
ERX1946873	41.1M	0.0M	7.8M	1.1M	0.0M	31.7M	15.9M	15.9M	15.9M	15.9M	20.8M	10.9M	31.7M	0.0M
ERX1946874	42.0M	0.0M	9.3M	1.2M	0.0M	31.0M	15.5M	15.5M	15.5M	15.5M	20.4M	10.6M	31.0M	0.0M
ERX1946875	36.0M	0.0M	6.9M	1.0M	0.0M	27.7M	13.8M	13.8M	13.8M	13.8M	18.2M	9.5M	27.7M	0.0M
ERX1946876	43.7M	0.0M	8.4M	1.2M	0.0M	33.5M	16.8M	16.8M	16.8M	16.8M	21.9M	11.6M	33.5M	0.0M
ERX1946877	39.7M	0.0M	5.9M	1.0M	0.0M	32.3M	16.1M	16.1M	16.1M	16.1M	20.9M	11.4M	32.3M	0.0M
ERX1946878	50.1M	0.0M	7.5M	1.3M	0.0M	40.6M	20.3M	20.3M	20.3M	20.3M	26.7M	13.9M	40.6M	0.0M
ERX1946879	41.0M	0.0M	5.8M	1.0M	0.0M	33.7M	16.9M	16.9M	16.9M	16.9M	22.3M	11.5M	33.7M	0.0M
ERX1946880	42.5M	0.0M	5.9M	1.0M	0.0M	35.2M	17.6M	17.6M	17.6M	17.6M	23.3M	11.9M	35.2M	0.0M
ERX1946881	47.7M	0.0M	7.8M	1.1M	0.0M	38.4M	19.2M	19.2M	19.2M	19.2M	25.5M	12.9M	38.4M	0.0M
ERX1946882	43.2M	0.0M	7.2M	1.0M	0.0M	34.5M	17.2M	17.2M	17.2M	17.2M	22.8M	11.7M	34.5M	0.0M
ERX1946883	48.4M	0.0M	8.3M	1.0M	0.0M	38.5M	19.3M	19.3M	19.3M	19.3M	25.2M	13.3M	38.5M	0.0M
ERX1946884	55.9M	0.0M	10.0M	1.3M	0.0M	44.1M	22.0M	22.0M	22.0M	22.0M	28.8M	15.3M	44.1M	0.0M
ERX1946885	44.2M	0.0M	7.3M	1.0M	0.0M	35.4M	17.7M	17.7M	17.7M	17.7M	23.1M	12.3M	35.4M	0.0M
ERX1946886	36.0M	0.0M	5.6M	0.9M	0.0M	29.0M	14.5M	14.5M	14.5M	14.5M	18.7M	10.3M	29.0M	0.0M
ERX1946887	36.1M	0.0M	5.4M	0.9M	0.0M	29.4M	14.7M	14.7M	14.7M	14.7M	19.1M	10.3M	29.4M	0.0M
ERX1946888	41.3M	0.0M	6.5M	1.1M	0.0M	33.2M	16.6M	16.6M	16.6M	16.6M	21.6M	11.7M	33.2M	0.0M
ERX1946889	43.1M	0.0M	7.4M	1.1M	0.0M	34.1M	17.1M	17.1M	17.1M	17.1M	22.1M	12.0M	34.1M	0.0M
ERX1946890	40.7M	0.0M	6.7M	1.1M	0.0M	32.5M	16.3M	16.3M	16.3M	16.3M	21.1M	11.5M	32.5M	0.0M
ERX1946891	45.5M	0.0M	8.3M	1.2M	0.0M	35.4M	17.7M	17.7M	17.7M	17.7M	22.9M	12.5M	35.4M	0.0M
ERX1946892	49.7M	0.0M	9.7M	1.3M	0.0M	38.2M	19.1M	19.1M	19.1M	19.1M	24.6M	13.6M	38.2M	0.0M
ERX1946893	41.9M	0.0M	7.5M	1.2M	0.0M	32.6M	16.3M	16.3M	16.3M	16.3M	21.1M	11.5M	32.6M	0.0M
ERX1946894	37.6M	0.0M	6.3M	1.0M	0.0M	29.9M	15.0M	15.0M	15.0M	15.0M	19.3M	10.6M	29.9M	0.0M
ERX1946895	43.4M	0.0M	6.8M	1.1M	0.0M	35.0M	17.5M	17.5M	17.5M	17.5M	22.7M	12.4M	35.0M	0.0M
ERX1946896	38.6M	0.0M	5.2M	1.1M	0.0M	31.9M	16.0M	16.0M	16.0M	16.0M	20.7M	11.2M	31.9M	0.0M
ERX1946897	42.8M	0.0M	7.0M	1.2M	0.0M	34.1M	17.0M	17.0M	17.0M	17.0M	22.0M	12.1M	34.1M	0.0M
ERX1946898	44.1M	0.0M	7.7M	1.2M	0.0M	34.7M	17.4M	17.4M	17.4M	17.4M	22.5M	12.2M	34.7M	0.0M
ERX1946899	47.9M	0.0M	10.4M	1.5M	0.0M	35.5M	17.8M	17.7M	17.7M	17.7M	23.2M	12.3M	35.5M	0.0M
ERX1946900	43.5M	0.0M	9.7M	1.3M	0.0M	32.1M	16.0M	16.0M	16.0M	16.0M	21.1M	11.0M	32.1M	0.0M
ERX1946901	41.9M	0.0M	8.6M	1.1M	0.0M	31.7M	15.9M	15.9M	15.9M	15.9M	20.8M	10.9M	31.7M	0.0M
ERX1946902	37.4M	0.0M	6.4M	1.0M	0.0M	29.6M	14.8M	14.8M	14.8M	14.8M	19.4M	10.2M	29.6M	0.0M
ERX1946903	35.7M	0.0M	5.3M	0.9M	0.0M	29.1M	14.5M	14.5M	14.5M	14.5M	18.8M	10.3M	29.1M	0.0M
ERX1946904	44.2M	0.0M	5.8M	1.2M	0.0M	36.7M	18.4M	18.4M	18.4M	18.4M	24.4M	12.3M	36.7M	0.0M
ERX1946905	53.5M	0.0M	8.5M	1.4M	0.0M	43.0M	21.5M	21.5M	21.5M	21.5M	28.5M	14.5M	43.0M	0.0M
ERX1946906	50.3M	0.0M	9.0M	1.2M	0.0M	39.6M	19.8M	19.8M	19.8M	19.8M	26.3M	13.3M	39.6M	0.0M
ERX1946907	55.6M	0.0M	9.0M	1.3M	0.0M	44.7M	22.4M	22.4M	22.4M	22.4M	29.7M	15.0M	44.7M	0.0M
ERX1946908	53.0M	0.0M	9.9M	1.3M	0.0M	41.1M	20.6M	20.6M	20.6M	20.6M	27.1M	14.1M	41.1M	0.0M
ERX1946909	48.8M	0.0M	8.5M	1.1M	0.0M	38.6M	19.3M	19.3M	19.3M	19.3M	25.3M	13.3M	38.6M	0.0M
ERX1946910	45.0M	0.0M	7.4M	1.0M	0.0M	36.1M	18.0M	18.0M	18.0M	18.0M	23.5M	12.6M	36.1M	0.0M
ERX1946911	45.5M	0.0M	7.0M	1.0M	0.0M	37.0M	18.5M	18.5M	18.5M	18.5M	24.1M	12.9M	37.0M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: rseqc_bam_stat_table-1

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non_splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper_paired_reads_map_to_different_chrom`	read_count

Samtools

Toolkit for interacting with BAM/CRAM files.URL: http://www.htslib.orgDOI: 10.1093/bioinformatics/btp352

Percent mapped

Alignment metrics from samtools stats; mapped vs. unmapped reads vs. reads mapped with MQ0.

For a set of samples that have come from the same multiplexed library, similar numbers of reads for each sample are expected. Large differences in numbers might indicate issues during the library preparation process. Whilst large differences in read numbers may be controlled for in downstream processings (e.g. read count normalisation), you may wish to consider whether the read depths achieved have fallen below recommended levels depending on the applications.

Low alignment rates could indicate contamination of samples (e.g. adapter sequences), low sequencing quality or other artefacts. These can be further investigated in the sequence level QC (e.g. from FastQC).

Reads mapped with MQ0 often indicate that the reads are ambiguously mapped to multiple locations in the reference sequence. This can be due to repetitive regions in the genome, the presence of alternative contigs in the reference, or due to reads that are too short to be uniquely mapped. These reads are often filtered out in downstream analyses.

Created with MultiQC

Alignment stats

This module parses the output from samtools stats. All numbers in millions.

Created with MultiQC

Showing ⁰/₂₃₄ rows and ¹³/₁₃ columns.

Sample Name	Total sequences	Mapped & paired	Properly paired	Duplicated	QC Failed	Reads MQ0	Mapped bases (CIGAR)	Bases Trimmed	Duplicated bases	Diff chromosomes	Other orientation	Inward pairs	Outward pairs
ERX1946678	39.2M	39.2M	39.2M	5.2M	0.0M	0.0M	3532.6Mb	0.0Mb	464.5Mb	0.0M	0.0M	19.5M	0.0M
ERX1946679	39.7M	39.7M	39.7M	0.0M	0.0M	0.0M	3582.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	19.8M	0.0M
ERX1946680	37.0M	37.0M	37.0M	5.9M	0.0M	0.0M	3338.3Mb	0.0Mb	533.3Mb	0.0M	0.0M	18.5M	0.0M
ERX1946681	30.0M	30.0M	30.0M	0.0M	0.0M	0.0M	2702.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	15.0M	0.0M
ERX1946682	35.8M	35.8M	35.8M	6.9M	0.0M	0.0M	3225.5Mb	0.0Mb	618.7Mb	0.0M	0.0M	17.9M	0.0M
ERX1946683	31.8M	31.7M	31.7M	6.0M	0.0M	0.0M	2861.9Mb	0.0Mb	542.7Mb	0.0M	0.0M	15.8M	0.0M
ERX1946684	47.6M	47.6M	47.6M	10.0M	0.0M	0.0M	4287.2Mb	0.0Mb	897.5Mb	0.0M	0.0M	23.7M	0.1M
ERX1946685	31.9M	31.8M	31.8M	0.0M	0.0M	0.0M	2871.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	15.9M	0.0M
ERX1946686	32.4M	32.4M	32.4M	0.0M	0.0M	0.0M	2922.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	16.2M	0.0M
ERX1946687	32.4M	32.4M	32.4M	0.0M	0.0M	0.0M	2927.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	16.2M	0.0M
ERX1946688	34.5M	34.5M	34.5M	0.0M	0.0M	0.0M	3116.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.2M	0.0M
ERX1946689	36.7M	36.7M	36.7M	0.0M	0.0M	0.0M	3317.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	18.3M	0.0M
ERX1946690	33.0M	33.0M	33.0M	0.0M	0.0M	0.0M	2983.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	16.5M	0.0M
ERX1946691	36.8M	36.8M	36.8M	0.0M	0.0M	0.0M	3350.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	18.4M	0.0M
ERX1946692	39.9M	39.9M	39.9M	7.1M	0.0M	0.0M	3606.3Mb	0.0Mb	642.5Mb	0.0M	0.0M	19.9M	0.1M
ERX1946693	35.1M	35.0M	35.0M	6.0M	0.0M	0.0M	3165.3Mb	0.0Mb	536.8Mb	0.0M	0.0M	17.5M	0.0M
ERX1946694	49.0M	49.0M	49.0M	9.3M	0.0M	0.0M	4425.7Mb	0.0Mb	839.6Mb	0.0M	0.0M	24.5M	0.0M
ERX1946695	45.4M	45.4M	45.4M	0.0M	0.0M	0.0M	4073.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	22.6M	0.0M
ERX1946696	35.4M	35.4M	35.4M	0.0M	0.0M	0.0M	3174.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.7M	0.0M
ERX1946697	36.5M	36.5M	36.5M	0.0M	0.0M	0.0M	3276.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	18.2M	0.0M
ERX1946698	41.5M	41.5M	41.5M	7.1M	0.0M	0.0M	3723.8Mb	0.0Mb	632.7Mb	0.0M	0.0M	20.7M	0.0M
ERX1946699	36.4M	36.3M	36.3M	0.0M	0.0M	0.0M	3262.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	18.1M	0.0M
ERX1946700	42.0M	42.0M	42.0M	6.9M	0.0M	0.0M	3770.7Mb	0.0Mb	615.8Mb	0.0M	0.0M	21.0M	0.0M
ERX1946701	47.4M	47.4M	47.4M	9.0M	0.0M	0.0M	4248.9Mb	0.0Mb	800.5Mb	0.0M	0.0M	23.6M	0.0M
ERX1946702	42.1M	42.1M	42.1M	0.0M	0.0M	0.0M	3775.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	21.0M	0.0M
ERX1946703	41.4M	41.4M	41.4M	6.9M	0.0M	0.0M	3719.2Mb	0.0Mb	617.3Mb	0.0M	0.0M	20.7M	0.0M
ERX1946704	39.7M	39.7M	39.7M	0.0M	0.0M	0.0M	3569.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	19.8M	0.0M
ERX1946705	39.1M	39.1M	39.1M	0.0M	0.0M	0.0M	3512.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	19.5M	0.0M
ERX1946706	32.6M	32.6M	32.6M	4.5M	0.0M	0.0M	2928.9Mb	0.0Mb	403.9Mb	0.0M	0.0M	16.3M	0.0M
ERX1946707	35.5M	35.4M	35.4M	0.0M	0.0M	0.0M	3187.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.7M	0.0M
ERX1946708	35.5M	35.5M	35.5M	6.5M	0.0M	0.0M	3189.8Mb	0.0Mb	581.7Mb	0.0M	0.0M	17.7M	0.0M
ERX1946709	37.8M	37.7M	37.7M	0.0M	0.0M	0.0M	3394.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	18.8M	0.0M
ERX1946710	32.1M	32.1M	32.1M	0.0M	0.0M	0.0M	2887.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	16.0M	0.0M
ERX1946711	37.1M	37.1M	37.1M	0.0M	0.0M	0.0M	3335.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	18.5M	0.0M
ERX1946712	34.0M	34.0M	34.0M	4.8M	0.0M	0.0M	3054.0Mb	0.0Mb	430.7Mb	0.0M	0.0M	17.0M	0.0M
ERX1946713	45.3M	45.2M	45.2M	0.0M	0.0M	0.0M	4073.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	22.6M	0.0M
ERX1946714	40.0M	40.0M	40.0M	0.0M	0.0M	0.0M	3601.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.0M	0.0M
ERX1946715	38.6M	38.6M	38.6M	5.2M	0.0M	0.0M	3475.9Mb	0.0Mb	470.7Mb	0.0M	0.0M	19.3M	0.0M
ERX1946716	42.6M	42.6M	42.6M	6.8M	0.0M	0.0M	3829.0Mb	0.0Mb	606.9Mb	0.0M	0.0M	21.2M	0.0M
ERX1946717	38.5M	38.4M	38.4M	0.0M	0.0M	0.0M	3461.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	19.2M	0.0M
ERX1946718	42.5M	42.5M	42.5M	7.0M	0.0M	0.0M	3825.6Mb	0.0Mb	629.3Mb	0.0M	0.0M	21.2M	0.0M
ERX1946719	49.7M	49.7M	49.7M	0.0M	0.0M	0.0M	4469.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	24.8M	0.0M
ERX1946720	39.4M	39.4M	39.4M	6.4M	0.0M	0.0M	3540.9Mb	0.0Mb	572.4Mb	0.0M	0.0M	19.7M	0.0M
ERX1946721	35.8M	35.8M	35.8M	5.8M	0.0M	0.0M	3222.8Mb	0.0Mb	522.0Mb	0.0M	0.0M	17.9M	0.0M
ERX1946722	35.5M	35.5M	35.5M	5.5M	0.0M	0.0M	3194.8Mb	0.0Mb	491.9Mb	0.0M	0.0M	17.7M	0.0M
ERX1946723	40.5M	40.5M	40.5M	6.6M	0.0M	0.0M	3641.1Mb	0.0Mb	589.4Mb	0.0M	0.0M	20.2M	0.0M
ERX1946724	42.3M	42.3M	42.3M	0.0M	0.0M	0.0M	3808.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	21.1M	0.1M
ERX1946725	40.3M	40.3M	40.3M	0.0M	0.0M	0.0M	3627.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.1M	0.0M
ERX1946726	45.1M	45.1M	45.1M	8.5M	0.0M	0.0M	4056.2Mb	0.0Mb	766.8Mb	0.0M	0.0M	22.5M	0.0M
ERX1946727	49.0M	49.0M	49.0M	9.9M	0.0M	0.0M	4408.1Mb	0.0Mb	885.0Mb	0.0M	0.0M	24.5M	0.0M
ERX1946728	41.1M	41.1M	41.1M	7.6M	0.0M	0.0M	3699.2Mb	0.0Mb	684.3Mb	0.0M	0.0M	20.5M	0.0M
ERX1946729	37.2M	37.2M	37.2M	0.0M	0.0M	0.0M	3349.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	18.6M	0.0M
ERX1946730	42.2M	42.2M	42.2M	6.8M	0.0M	0.0M	3800.6Mb	0.0Mb	606.2Mb	0.0M	0.0M	21.1M	0.0M
ERX1946731	38.4M	38.4M	38.4M	0.0M	0.0M	0.0M	3460.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	19.2M	0.0M
ERX1946732	41.5M	41.5M	41.5M	0.0M	0.0M	0.0M	3735.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.7M	0.0M
ERX1946733	42.6M	42.6M	42.6M	0.0M	0.0M	0.0M	3837.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	21.3M	0.0M
ERX1946734	46.0M	46.0M	46.0M	0.0M	0.0M	0.0M	4139.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	23.0M	0.0M
ERX1946735	41.8M	41.8M	41.8M	9.5M	0.0M	0.0M	3763.1Mb	0.0Mb	851.7Mb	0.0M	0.0M	20.9M	0.0M
ERX1946736	40.5M	40.5M	40.5M	0.0M	0.0M	0.0M	3646.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.2M	0.0M
ERX1946737	36.3M	36.3M	36.3M	6.4M	0.0M	0.0M	3266.5Mb	0.0Mb	571.3Mb	0.0M	0.0M	18.1M	0.0M
ERX1946738	34.8M	34.8M	34.8M	5.3M	0.0M	0.0M	3134.3Mb	0.0Mb	476.6Mb	0.0M	0.0M	17.4M	0.0M
ERX1946739	41.3M	41.3M	41.3M	0.0M	0.0M	0.0M	3709.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.6M	0.0M
ERX1946740	49.9M	49.9M	49.9M	7.9M	0.0M	0.0M	4493.1Mb	0.0Mb	708.9Mb	0.0M	0.0M	24.9M	0.1M
ERX1946741	46.5M	46.5M	46.5M	0.0M	0.0M	0.0M	4179.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	23.2M	0.0M
ERX1946742	51.9M	51.9M	51.9M	0.0M	0.0M	0.0M	4664.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	25.9M	0.0M
ERX1946743	47.9M	47.8M	47.8M	8.8M	0.0M	0.0M	4302.8Mb	0.0Mb	784.8Mb	0.0M	0.0M	23.9M	0.0M
ERX1946744	46.0M	46.0M	46.0M	8.0M	0.0M	0.0M	4134.9Mb	0.0Mb	717.7Mb	0.0M	0.0M	23.0M	0.0M
ERX1946745	42.2M	42.2M	42.2M	0.0M	0.0M	0.0M	3794.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	21.1M	0.0M
ERX1946746	41.5M	41.4M	41.4M	6.2M	0.0M	0.0M	3726.2Mb	0.0Mb	558.9Mb	0.0M	0.0M	20.7M	0.0M
ERX1946747	32.8M	32.8M	32.8M	9.2M	0.0M	0.0M	3226.6Mb	0.0Mb	904.4Mb	0.0M	0.0M	16.4M	0.0M
ERX1946748	32.7M	32.7M	32.7M	0.0M	0.0M	0.0M	3217.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	16.3M	0.0M
ERX1946749	33.2M	33.2M	33.2M	0.0M	0.0M	0.0M	3260.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	16.5M	0.0M
ERX1946750	33.0M	33.0M	33.0M	5.2M	0.0M	0.0M	3251.8Mb	0.0Mb	511.7Mb	0.0M	0.0M	16.5M	0.0M
ERX1946751	32.9M	32.9M	32.9M	5.2M	0.0M	0.0M	3241.9Mb	0.0Mb	509.8Mb	0.0M	0.0M	16.4M	0.0M
ERX1946752	33.4M	33.4M	33.4M	5.3M	0.0M	0.0M	3288.9Mb	0.0Mb	521.8Mb	0.0M	0.0M	16.7M	0.0M
ERX1946753	44.5M	44.5M	44.5M	0.0M	0.0M	0.0M	4386.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	22.2M	0.0M
ERX1946754	44.4M	44.4M	44.4M	0.0M	0.0M	0.0M	4369.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	22.1M	0.0M
ERX1946755	45.0M	45.0M	45.0M	0.0M	0.0M	0.0M	4428.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	22.4M	0.0M
ERX1946756	49.1M	49.1M	49.1M	0.0M	0.0M	0.0M	4834.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	24.5M	0.1M
ERX1946757	48.9M	48.9M	48.9M	0.0M	0.0M	0.0M	4815.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	24.4M	0.1M
ERX1946758	49.5M	49.5M	49.5M	9.5M	0.0M	0.0M	4875.2Mb	0.0Mb	931.9Mb	0.0M	0.0M	24.7M	0.1M
ERX1946759	44.3M	44.3M	44.3M	8.1M	0.0M	0.0M	4358.0Mb	0.0Mb	798.7Mb	0.0M	0.0M	22.1M	0.0M
ERX1946760	44.1M	44.1M	44.1M	0.0M	0.0M	0.0M	4342.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	22.0M	0.0M
ERX1946761	44.8M	44.8M	44.8M	8.3M	0.0M	0.0M	4404.6Mb	0.0Mb	812.2Mb	0.0M	0.0M	22.3M	0.0M
ERX1946762	33.2M	33.2M	33.2M	0.0M	0.0M	0.0M	3267.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	16.6M	0.0M
ERX1946763	33.1M	33.0M	33.0M	0.0M	0.0M	0.0M	3254.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	16.5M	0.0M
ERX1946764	33.5M	33.5M	33.5M	0.0M	0.0M	0.0M	3298.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	16.7M	0.0M
ERX1946765	34.5M	34.5M	34.5M	5.4M	0.0M	0.0M	3399.0Mb	0.0Mb	532.7Mb	0.0M	0.0M	17.2M	0.0M
ERX1946766	34.4M	34.4M	34.4M	0.0M	0.0M	0.0M	3388.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.1M	0.0M
ERX1946767	34.7M	34.7M	34.7M	5.5M	0.0M	0.0M	3421.0Mb	0.0Mb	539.5Mb	0.0M	0.0M	17.3M	0.0M
ERX1946768	43.0M	43.0M	43.0M	0.0M	0.0M	0.0M	4240.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	21.5M	0.1M
ERX1946769	42.9M	42.9M	42.9M	0.0M	0.0M	0.0M	4224.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	21.4M	0.1M
ERX1946770	43.5M	43.5M	43.5M	0.0M	0.0M	0.0M	4286.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	21.7M	0.1M
ERX1946771	55.6M	55.5M	55.5M	11.3M	0.0M	0.0M	5464.0Mb	0.0Mb	1111.0Mb	0.0M	0.0M	27.7M	0.0M
ERX1946772	55.4M	55.3M	55.3M	0.0M	0.0M	0.0M	5443.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	27.6M	0.0M
ERX1946773	56.0M	56.0M	56.0M	11.5M	0.0M	0.0M	5510.6Mb	0.0Mb	1125.8Mb	0.0M	0.0M	28.0M	0.0M
ERX1946774	36.7M	36.7M	36.7M	0.0M	0.0M	0.0M	3552.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	18.3M	0.0M
ERX1946775	37.1M	37.1M	37.1M	5.2M	0.0M	0.0M	3585.6Mb	0.0Mb	500.6Mb	0.0M	0.0M	18.5M	0.0M
ERX1946776	34.8M	34.8M	34.8M	0.0M	0.0M	0.0M	3365.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.4M	0.0M
ERX1946777	28.2M	28.2M	28.2M	4.3M	0.0M	0.0M	2722.7Mb	0.0Mb	415.2Mb	0.0M	0.0M	14.1M	0.0M
ERX1946778	33.6M	33.6M	33.6M	6.3M	0.0M	0.0M	3246.9Mb	0.0Mb	602.9Mb	0.0M	0.0M	16.8M	0.0M
ERX1946779	29.7M	29.7M	29.7M	0.0M	0.0M	0.0M	2866.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	14.8M	0.0M
ERX1946780	44.7M	44.7M	44.7M	0.0M	0.0M	0.0M	4307.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	22.3M	0.1M
ERX1946781	29.8M	29.8M	29.8M	4.7M	0.0M	0.0M	2880.0Mb	0.0Mb	444.0Mb	0.0M	0.0M	14.9M	0.0M
ERX1946782	30.3M	30.3M	30.3M	4.4M	0.0M	0.0M	2930.7Mb	0.0Mb	424.8Mb	0.0M	0.0M	15.1M	0.0M
ERX1946783	30.8M	30.7M	30.7M	4.4M	0.0M	0.0M	2987.7Mb	0.0Mb	426.6Mb	0.0M	0.0M	15.4M	0.0M
ERX1946784	32.7M	32.7M	32.7M	4.1M	0.0M	0.0M	3175.7Mb	0.0Mb	391.8Mb	0.0M	0.0M	16.3M	0.0M
ERX1946785	34.7M	34.7M	34.7M	0.0M	0.0M	0.0M	3466.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.3M	0.0M
ERX1946786	31.0M	31.0M	31.0M	4.7M	0.0M	0.0M	3015.0Mb	0.0Mb	456.6Mb	0.0M	0.0M	15.5M	0.0M
ERX1946787	34.8M	34.8M	34.8M	0.0M	0.0M	0.0M	3377.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.4M	0.0M
ERX1946788	37.7M	37.7M	37.7M	6.6M	0.0M	0.0M	3659.2Mb	0.0Mb	629.8Mb	0.0M	0.0M	18.8M	0.1M
ERX1946789	33.3M	33.2M	33.2M	5.5M	0.0M	0.0M	3228.7Mb	0.0Mb	529.3Mb	0.0M	0.0M	16.6M	0.0M
ERX1946790	46.7M	46.7M	46.7M	8.7M	0.0M	0.0M	4535.5Mb	0.0Mb	836.3Mb	0.0M	0.0M	23.3M	0.0M
ERX1946791	43.0M	43.0M	43.0M	0.0M	0.0M	0.0M	4129.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	21.5M	0.0M
ERX1946792	33.6M	33.6M	33.6M	0.0M	0.0M	0.0M	3216.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	16.8M	0.0M
ERX1946793	34.8M	34.8M	34.8M	0.0M	0.0M	0.0M	3337.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.4M	0.0M
ERX1946794	39.5M	39.5M	39.5M	6.6M	0.0M	0.0M	3780.2Mb	0.0Mb	622.4Mb	0.0M	0.0M	19.7M	0.0M
ERX1946795	34.7M	34.6M	34.6M	5.2M	0.0M	0.0M	3319.7Mb	0.0Mb	491.8Mb	0.0M	0.0M	17.3M	0.0M
ERX1946796	40.2M	40.1M	40.1M	0.0M	0.0M	0.0M	3848.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.0M	0.0M
ERX1946797	45.5M	45.5M	45.5M	0.0M	0.0M	0.0M	4353.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	22.7M	0.0M
ERX1946798	40.3M	40.2M	40.2M	7.1M	0.0M	0.0M	3851.4Mb	0.0Mb	670.3Mb	0.0M	0.0M	20.1M	0.0M
ERX1946799	39.4M	39.4M	39.4M	6.4M	0.0M	0.0M	3775.5Mb	0.0Mb	605.5Mb	0.0M	0.0M	19.7M	0.0M
ERX1946800	39.5M	39.5M	39.5M	0.0M	0.0M	0.0M	3723.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	19.7M	0.0M
ERX1946801	37.8M	37.8M	37.8M	0.0M	0.0M	0.0M	3566.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	18.9M	0.0M
ERX1946802	32.1M	32.1M	32.1M	4.4M	0.0M	0.0M	3019.7Mb	0.0Mb	408.0Mb	0.0M	0.0M	16.0M	0.0M
ERX1946803	34.1M	34.1M	34.1M	0.0M	0.0M	0.0M	3214.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.0M	0.0M
ERX1946804	35.3M	35.3M	35.3M	6.5M	0.0M	0.0M	3322.3Mb	0.0Mb	598.2Mb	0.0M	0.0M	17.6M	0.0M
ERX1946805	37.3M	37.3M	37.3M	8.1M	0.0M	0.0M	3513.3Mb	0.0Mb	756.2Mb	0.0M	0.0M	18.6M	0.0M
ERX1946806	31.5M	31.5M	31.5M	0.0M	0.0M	0.0M	2959.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	15.7M	0.0M
ERX1946807	37.0M	37.0M	37.0M	6.8M	0.0M	0.0M	3491.6Mb	0.0Mb	633.6Mb	0.0M	0.0M	18.5M	0.0M
ERX1946808	34.2M	34.2M	34.2M	4.9M	0.0M	0.0M	3219.4Mb	0.0Mb	450.9Mb	0.0M	0.0M	17.1M	0.0M
ERX1946809	44.0M	44.0M	44.0M	0.0M	0.0M	0.0M	4228.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	22.0M	0.0M
ERX1946810	37.9M	37.9M	37.9M	0.0M	0.0M	0.0M	3638.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	18.9M	0.0M
ERX1946811	37.5M	37.5M	37.5M	0.0M	0.0M	0.0M	3602.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	18.7M	0.0M
ERX1946812	41.5M	41.5M	41.5M	0.0M	0.0M	0.0M	3984.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.7M	0.0M
ERX1946813	37.6M	37.5M	37.5M	6.0M	0.0M	0.0M	3605.8Mb	0.0Mb	570.6Mb	0.0M	0.0M	18.7M	0.0M
ERX1946814	41.7M	41.7M	41.7M	0.0M	0.0M	0.0M	4003.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.8M	0.0M
ERX1946815	49.0M	48.9M	48.9M	8.5M	0.0M	0.0M	4688.8Mb	0.0Mb	800.7Mb	0.0M	0.0M	24.4M	0.0M
ERX1946816	38.5M	38.5M	38.5M	6.2M	0.0M	0.0M	3690.8Mb	0.0Mb	583.0Mb	0.0M	0.0M	19.2M	0.0M
ERX1946817	34.1M	34.1M	34.1M	0.0M	0.0M	0.0M	3305.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.0M	0.0M
ERX1946818	33.8M	33.8M	33.8M	5.1M	0.0M	0.0M	3276.4Mb	0.0Mb	491.3Mb	0.0M	0.0M	16.9M	0.0M
ERX1946819	38.4M	38.4M	38.4M	0.0M	0.0M	0.0M	3715.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	19.2M	0.0M
ERX1946820	39.8M	39.7M	39.7M	6.9M	0.0M	0.0M	3854.9Mb	0.0Mb	659.3Mb	0.0M	0.0M	19.8M	0.0M
ERX1946821	38.1M	38.1M	38.1M	0.0M	0.0M	0.0M	3698.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	19.0M	0.0M
ERX1946822	42.8M	42.8M	42.8M	7.9M	0.0M	0.0M	4152.5Mb	0.0Mb	764.0Mb	0.0M	0.0M	21.4M	0.0M
ERX1946823	46.4M	46.3M	46.3M	9.1M	0.0M	0.0M	4495.5Mb	0.0Mb	877.2Mb	0.0M	0.0M	23.1M	0.0M
ERX1946824	39.1M	39.0M	39.0M	0.0M	0.0M	0.0M	3784.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	19.5M	0.0M
ERX1946825	35.4M	35.4M	35.4M	0.0M	0.0M	0.0M	3430.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.7M	0.0M
ERX1946826	40.3M	40.2M	40.2M	0.0M	0.0M	0.0M	3910.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.1M	0.0M
ERX1946827	36.2M	36.2M	36.2M	0.0M	0.0M	0.0M	3512.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	18.1M	0.0M
ERX1946828	39.6M	39.6M	39.6M	0.0M	0.0M	0.0M	3846.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	19.8M	0.0M
ERX1946829	40.8M	40.8M	40.8M	0.0M	0.0M	0.0M	3954.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.4M	0.0M
ERX1946830	44.1M	44.1M	44.1M	9.7M	0.0M	0.0M	4280.5Mb	0.0Mb	931.1Mb	0.0M	0.0M	22.0M	0.0M
ERX1946831	40.1M	40.1M	40.1M	9.0M	0.0M	0.0M	3890.6Mb	0.0Mb	864.0Mb	0.0M	0.0M	20.0M	0.0M
ERX1946832	39.2M	39.2M	39.2M	8.1M	0.0M	0.0M	3795.7Mb	0.0Mb	774.7Mb	0.0M	0.0M	19.6M	0.0M
ERX1946833	34.9M	34.9M	34.9M	0.0M	0.0M	0.0M	3385.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.4M	0.0M
ERX1946834	33.2M	33.2M	33.2M	5.0M	0.0M	0.0M	3222.2Mb	0.0Mb	476.0Mb	0.0M	0.0M	16.6M	0.0M
ERX1946835	40.1M	40.1M	40.1M	0.0M	0.0M	0.0M	3849.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.0M	0.0M
ERX1946836	48.2M	48.2M	48.2M	7.5M	0.0M	0.0M	4647.4Mb	0.0Mb	713.7Mb	0.0M	0.0M	24.0M	0.1M
ERX1946837	45.0M	45.0M	45.0M	0.0M	0.0M	0.0M	4332.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	22.5M	0.0M
ERX1946838	50.0M	50.0M	50.0M	0.0M	0.0M	0.0M	4808.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	24.9M	0.0M
ERX1946839	46.2M	46.2M	46.2M	0.0M	0.0M	0.0M	4443.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	23.0M	0.0M
ERX1946840	44.6M	44.5M	44.5M	0.0M	0.0M	0.0M	4283.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	22.2M	0.0M
ERX1946841	40.6M	40.6M	40.6M	6.5M	0.0M	0.0M	3904.4Mb	0.0Mb	621.9Mb	0.0M	0.0M	20.3M	0.0M
ERX1946842	40.0M	40.0M	40.0M	5.9M	0.0M	0.0M	3848.1Mb	0.0Mb	561.9Mb	0.0M	0.0M	19.9M	0.0M
ERX1946843	41.2M	41.2M	41.2M	5.6M	0.0M	0.0M	4064.0Mb	0.0Mb	552.8Mb	0.0M	0.0M	20.6M	0.0M
ERX1946844	39.9M	39.9M	39.9M	5.9M	0.0M	0.0M	3938.4Mb	0.0Mb	575.4Mb	0.0M	0.0M	19.9M	0.0M
ERX1946845	39.0M	39.0M	39.0M	6.4M	0.0M	0.0M	3844.9Mb	0.0Mb	631.8Mb	0.0M	0.0M	19.4M	0.0M
ERX1946846	32.1M	32.1M	32.1M	0.0M	0.0M	0.0M	3166.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	16.0M	0.0M
ERX1946847	38.1M	38.1M	38.1M	7.6M	0.0M	0.0M	3762.5Mb	0.0Mb	746.1Mb	0.0M	0.0M	19.0M	0.0M
ERX1946848	33.8M	33.8M	33.8M	6.7M	0.0M	0.0M	3331.7Mb	0.0Mb	653.8Mb	0.0M	0.0M	16.9M	0.0M
ERX1946849	50.6M	50.6M	50.6M	0.0M	0.0M	0.0M	4983.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	25.2M	0.1M
ERX1946850	34.2M	34.2M	34.2M	0.0M	0.0M	0.0M	3379.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.1M	0.0M
ERX1946851	34.0M	34.0M	34.0M	5.3M	0.0M	0.0M	3359.5Mb	0.0Mb	523.0Mb	0.0M	0.0M	17.0M	0.0M
ERX1946852	34.9M	34.9M	34.9M	5.4M	0.0M	0.0M	3449.3Mb	0.0Mb	532.8Mb	0.0M	0.0M	17.4M	0.0M
ERX1946853	36.9M	36.9M	36.9M	0.0M	0.0M	0.0M	3642.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	18.4M	0.0M
ERX1946854	39.6M	39.6M	39.6M	0.0M	0.0M	0.0M	3916.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	19.8M	0.0M
ERX1946855	35.4M	35.3M	35.3M	5.8M	0.0M	0.0M	3495.4Mb	0.0Mb	573.4Mb	0.0M	0.0M	17.6M	0.0M
ERX1946856	40.5M	40.5M	40.5M	6.9M	0.0M	0.0M	4001.2Mb	0.0Mb	683.4Mb	0.0M	0.0M	20.2M	0.0M
ERX1946857	42.6M	42.6M	42.6M	0.0M	0.0M	0.0M	4211.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	21.2M	0.1M
ERX1946858	38.0M	38.0M	38.0M	6.7M	0.0M	0.0M	3753.8Mb	0.0Mb	664.8Mb	0.0M	0.0M	19.0M	0.0M
ERX1946859	54.2M	54.2M	54.2M	10.8M	0.0M	0.0M	5354.1Mb	0.0Mb	1066.6Mb	0.0M	0.0M	27.1M	0.0M
ERX1946860	44.3M	44.3M	44.3M	6.9M	0.0M	0.0M	4366.4Mb	0.0Mb	678.0Mb	0.0M	0.0M	22.1M	0.0M
ERX1946861	34.3M	34.3M	34.3M	0.0M	0.0M	0.0M	3377.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.1M	0.0M
ERX1946862	35.8M	35.8M	35.8M	5.3M	0.0M	0.0M	3525.3Mb	0.0Mb	517.7Mb	0.0M	0.0M	17.9M	0.0M
ERX1946863	40.9M	40.9M	40.9M	0.0M	0.0M	0.0M	4025.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.4M	0.0M
ERX1946864	35.8M	35.8M	35.8M	5.5M	0.0M	0.0M	3525.3Mb	0.0Mb	534.9Mb	0.0M	0.0M	17.9M	0.0M
ERX1946865	41.3M	41.3M	41.3M	0.0M	0.0M	0.0M	4065.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.6M	0.0M
ERX1946866	46.5M	46.5M	46.5M	8.7M	0.0M	0.0M	4571.2Mb	0.0Mb	853.9Mb	0.0M	0.0M	23.2M	0.0M
ERX1946867	41.3M	41.2M	41.2M	7.4M	0.0M	0.0M	4058.8Mb	0.0Mb	720.1Mb	0.0M	0.0M	20.6M	0.0M
ERX1946868	40.5M	40.5M	40.5M	6.7M	0.0M	0.0M	3987.5Mb	0.0Mb	652.7Mb	0.0M	0.0M	20.2M	0.0M
ERX1946869	43.4M	43.4M	43.4M	7.4M	0.0M	0.0M	4250.5Mb	0.0Mb	724.6Mb	0.0M	0.0M	21.7M	0.0M
ERX1946870	41.4M	41.4M	41.4M	0.0M	0.0M	0.0M	4060.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.7M	0.0M
ERX1946871	35.2M	35.2M	35.2M	5.1M	0.0M	0.0M	3451.3Mb	0.0Mb	496.2Mb	0.0M	0.0M	17.6M	0.0M
ERX1946872	37.8M	37.8M	37.8M	6.4M	0.0M	0.0M	3708.0Mb	0.0Mb	621.7Mb	0.0M	0.0M	18.9M	0.0M
ERX1946873	40.0M	40.0M	40.0M	7.8M	0.0M	0.0M	3918.7Mb	0.0Mb	759.6Mb	0.0M	0.0M	20.0M	0.0M
ERX1946874	40.7M	40.7M	40.7M	9.3M	0.0M	0.0M	3994.8Mb	0.0Mb	904.4Mb	0.0M	0.0M	20.3M	0.0M
ERX1946875	35.0M	35.0M	35.0M	0.0M	0.0M	0.0M	3430.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.5M	0.0M
ERX1946876	42.5M	42.4M	42.4M	0.0M	0.0M	0.0M	4162.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	21.2M	0.0M
ERX1946877	38.7M	38.7M	38.7M	0.0M	0.0M	0.0M	3787.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	19.3M	0.0M
ERX1946878	48.7M	48.7M	48.7M	0.0M	0.0M	0.0M	4795.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	24.3M	0.0M
ERX1946879	40.0M	40.0M	40.0M	0.0M	0.0M	0.0M	3937.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.0M	0.0M
ERX1946880	41.5M	41.5M	41.5M	0.0M	0.0M	0.0M	4088.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.7M	0.0M
ERX1946881	46.7M	46.7M	46.7M	0.0M	0.0M	0.0M	4590.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	23.3M	0.0M
ERX1946882	42.2M	42.2M	42.2M	7.2M	0.0M	0.0M	4154.1Mb	0.0Mb	705.7Mb	0.0M	0.0M	21.1M	0.0M
ERX1946883	47.3M	47.3M	47.3M	8.3M	0.0M	0.0M	4655.1Mb	0.0Mb	809.6Mb	0.0M	0.0M	23.6M	0.0M
ERX1946884	54.6M	54.6M	54.6M	10.0M	0.0M	0.0M	5369.7Mb	0.0Mb	975.4Mb	0.0M	0.0M	27.3M	0.0M
ERX1946885	43.2M	43.1M	43.1M	7.3M	0.0M	0.0M	4244.2Mb	0.0Mb	717.3Mb	0.0M	0.0M	21.5M	0.0M
ERX1946886	35.1M	35.1M	35.1M	5.6M	0.0M	0.0M	3463.3Mb	0.0Mb	555.0Mb	0.0M	0.0M	17.5M	0.0M
ERX1946887	35.2M	35.2M	35.2M	0.0M	0.0M	0.0M	3476.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	17.6M	0.0M
ERX1946888	40.2M	40.2M	40.2M	0.0M	0.0M	0.0M	3967.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.1M	0.0M
ERX1946889	42.0M	42.0M	42.0M	0.0M	0.0M	0.0M	4147.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	21.0M	0.0M
ERX1946890	39.7M	39.7M	39.7M	0.0M	0.0M	0.0M	3915.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	19.8M	0.0M
ERX1946891	44.3M	44.2M	44.2M	0.0M	0.0M	0.0M	4368.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	22.1M	0.0M
ERX1946892	48.4M	48.4M	48.4M	9.7M	0.0M	0.0M	4778.1Mb	0.0Mb	951.5Mb	0.0M	0.0M	24.2M	0.0M
ERX1946893	40.7M	40.7M	40.7M	7.5M	0.0M	0.0M	4015.0Mb	0.0Mb	737.7Mb	0.0M	0.0M	20.3M	0.0M
ERX1946894	36.7M	36.6M	36.6M	6.3M	0.0M	0.0M	3617.7Mb	0.0Mb	617.6Mb	0.0M	0.0M	18.3M	0.0M
ERX1946895	42.3M	42.3M	42.3M	6.8M	0.0M	0.0M	4177.9Mb	0.0Mb	667.3Mb	0.0M	0.0M	21.1M	0.0M
ERX1946896	37.5M	37.5M	37.5M	5.2M	0.0M	0.0M	3705.0Mb	0.0Mb	507.3Mb	0.0M	0.0M	18.7M	0.0M
ERX1946897	41.5M	41.5M	41.5M	0.0M	0.0M	0.0M	4100.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	20.7M	0.0M
ERX1946898	43.0M	42.9M	42.9M	0.0M	0.0M	0.0M	4240.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	21.5M	0.0M
ERX1946899	46.5M	46.4M	46.4M	0.0M	0.0M	0.0M	4587.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	23.2M	0.0M
ERX1946900	42.3M	42.2M	42.2M	9.7M	0.0M	0.0M	4171.5Mb	0.0Mb	951.2Mb	0.0M	0.0M	21.1M	0.0M
ERX1946901	40.8M	40.8M	40.8M	8.6M	0.0M	0.0M	4023.8Mb	0.0Mb	841.6Mb	0.0M	0.0M	20.3M	0.0M
ERX1946902	36.5M	36.5M	36.5M	6.4M	0.0M	0.0M	3600.1Mb	0.0Mb	632.7Mb	0.0M	0.0M	18.2M	0.0M
ERX1946903	34.8M	34.8M	34.8M	5.3M	0.0M	0.0M	3439.7Mb	0.0Mb	523.9Mb	0.0M	0.0M	17.4M	0.0M
ERX1946904	43.1M	43.1M	43.1M	0.0M	0.0M	0.0M	4231.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	21.5M	0.0M
ERX1946905	52.1M	52.0M	52.0M	0.0M	0.0M	0.0M	5126.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	26.0M	0.1M
ERX1946906	49.1M	49.1M	49.1M	0.0M	0.0M	0.0M	4831.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	24.5M	0.1M
ERX1946907	54.3M	54.3M	54.3M	9.0M	0.0M	0.0M	5339.9Mb	0.0Mb	877.6Mb	0.0M	0.0M	27.1M	0.0M
ERX1946908	51.7M	51.6M	51.6M	9.9M	0.0M	0.0M	5080.8Mb	0.0Mb	969.2Mb	0.0M	0.0M	25.8M	0.0M
ERX1946909	47.6M	47.6M	47.6M	0.0M	0.0M	0.0M	4680.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	23.8M	0.0M
ERX1946910	44.0M	44.0M	44.0M	7.4M	0.0M	0.0M	4325.0Mb	0.0Mb	726.6Mb	0.0M	0.0M	22.0M	0.0M
ERX1946911	44.5M	44.5M	44.5M	0.0M	0.0M	0.0M	4375.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	22.2M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-stats-dp_table-1

Sort	Column	Description	ID	Scale
\|\|	Total sequences	Total sequences	`raw_total_sequences`	read_count
\|\|	Mapped & paired	Paired-end technology bit set + both mates mapped	`reads_mapped_and_paired`	read_count
\|\|	Properly paired	Proper-pair bit set	`reads_properly_paired`	read_count
\|\|	Duplicated	PCR or optical duplicate bit set	`reads_duplicated`	read_count
\|\|	QC Failed	QC Failed	`reads_QC_failed`	read_count
\|\|	Reads MQ0	Reads mapped and MQ=0	`reads_MQ0`	read_count
\|\|	Mapped bases (CIGAR)	Mapped bases (CIGAR)	`bases_mapped__cigar`	base_count
\|\|	Bases Trimmed	Bases Trimmed	`bases_trimmed`	base_count
\|\|	Duplicated bases	Duplicated bases	`bases_duplicated`	base_count
\|\|	Diff chromosomes	Pairs on different chromosomes	`pairs_on_different_chromosomes`	read_count
\|\|	Other orientation	Pairs with other orientation	`pairs_with_other_orientation`	read_count
\|\|	Inward pairs	Inward oriented pairs	`inward_oriented_pairs`	read_count
\|\|	Outward pairs	Outward oriented pairs	`outward_oriented_pairs`	read_count

Flagstat

This module parses the output from samtools flagstat

Created with MultiQC

Showing ⁰/₂₃₄ rows and ¹¹/₁₁ columns.

Sample Name	Total Reads	Total Passed QC	Mapped	Secondary Alignments	Duplicates	Paired in Sequencing	Properly Paired	Self and mate mapped	Singletons	Mate mapped to diff chr	Diff chr (mapQ >= 5)
ERX1946678	40.1M	40.1M	40.1M	1.0M	5.2M	39.2M	39.2M	39.2M	0.0M	0.0M	0.0M
ERX1946679	40.9M	40.9M	40.9M	1.2M	5.8M	39.7M	39.7M	39.7M	0.0M	0.0M	0.0M
ERX1946680	38.2M	38.2M	38.2M	1.2M	0.0M	37.0M	37.0M	37.0M	0.0M	0.0M	0.0M
ERX1946681	30.8M	30.8M	30.8M	0.8M	0.0M	30.0M	30.0M	30.0M	0.0M	0.0M	0.0M
ERX1946682	36.9M	36.9M	36.9M	1.1M	6.9M	35.8M	35.8M	35.8M	0.0M	0.0M	0.0M
ERX1946683	32.6M	32.6M	32.6M	0.9M	0.0M	31.8M	31.7M	31.7M	0.0M	0.0M	0.0M
ERX1946684	49.0M	49.0M	49.0M	1.4M	0.0M	47.6M	47.6M	47.6M	0.0M	0.0M	0.0M
ERX1946685	32.7M	32.7M	32.7M	0.9M	5.1M	31.9M	31.8M	31.8M	0.0M	0.0M	0.0M
ERX1946686	33.3M	33.3M	33.3M	0.9M	0.0M	32.4M	32.4M	32.4M	0.0M	0.0M	0.0M
ERX1946687	33.7M	33.7M	33.7M	1.3M	4.8M	32.4M	32.4M	32.4M	0.0M	0.0M	0.0M
ERX1946688	35.4M	35.4M	35.4M	0.8M	0.0M	34.5M	34.5M	34.5M	0.0M	0.0M	0.0M
ERX1946689	37.6M	37.6M	37.6M	0.9M	0.0M	36.7M	36.7M	36.7M	0.0M	0.0M	0.0M
ERX1946690	33.7M	33.7M	33.7M	0.7M	0.0M	33.0M	33.0M	33.0M	0.0M	0.0M	0.0M
ERX1946691	37.8M	37.8M	37.8M	1.1M	6.0M	36.8M	36.8M	36.8M	0.0M	0.0M	0.0M
ERX1946692	41.8M	41.8M	41.8M	1.9M	0.0M	39.9M	39.9M	39.9M	0.0M	0.0M	0.0M
ERX1946693	36.2M	36.2M	36.2M	1.1M	6.0M	35.1M	35.0M	35.0M	0.0M	0.0M	0.0M
ERX1946694	50.4M	50.4M	50.4M	1.4M	0.0M	49.0M	49.0M	49.0M	0.0M	0.0M	0.0M
ERX1946695	46.3M	46.3M	46.3M	1.0M	7.2M	45.4M	45.4M	45.4M	0.0M	0.0M	0.0M
ERX1946696	36.2M	36.2M	36.2M	0.8M	0.0M	35.4M	35.4M	35.4M	0.0M	0.0M	0.0M
ERX1946697	37.4M	37.4M	37.4M	0.9M	5.4M	36.5M	36.5M	36.5M	0.0M	0.0M	0.0M
ERX1946698	42.5M	42.5M	42.5M	1.0M	7.1M	41.5M	41.5M	41.5M	0.0M	0.0M	0.0M
ERX1946699	37.2M	37.2M	37.2M	0.9M	0.0M	36.4M	36.3M	36.3M	0.0M	0.0M	0.0M
ERX1946700	43.0M	43.0M	43.0M	1.0M	0.0M	42.0M	42.0M	42.0M	0.0M	0.0M	0.0M
ERX1946701	48.7M	48.7M	48.7M	1.3M	9.0M	47.4M	47.4M	47.4M	0.0M	0.0M	0.0M
ERX1946702	43.1M	43.1M	43.1M	1.0M	7.6M	42.1M	42.1M	42.1M	0.0M	0.0M	0.0M
ERX1946703	42.4M	42.4M	42.4M	1.0M	6.9M	41.4M	41.4M	41.4M	0.0M	0.0M	0.0M
ERX1946704	40.9M	40.9M	40.9M	1.2M	0.0M	39.7M	39.7M	39.7M	0.0M	0.0M	0.0M
ERX1946705	40.2M	40.2M	40.2M	1.2M	0.0M	39.1M	39.1M	39.1M	0.0M	0.0M	0.0M
ERX1946706	33.5M	33.5M	33.5M	0.9M	0.0M	32.6M	32.6M	32.6M	0.0M	0.0M	0.0M
ERX1946707	36.4M	36.4M	36.4M	1.0M	5.8M	35.5M	35.4M	35.4M	0.0M	0.0M	0.0M
ERX1946708	36.5M	36.5M	36.5M	1.0M	0.0M	35.5M	35.5M	35.5M	0.0M	0.0M	0.0M
ERX1946709	38.8M	38.8M	38.8M	1.1M	8.3M	37.8M	37.7M	37.7M	0.0M	0.0M	0.0M
ERX1946710	33.0M	33.0M	33.0M	0.9M	0.0M	32.1M	32.1M	32.1M	0.0M	0.0M	0.0M
ERX1946711	38.2M	38.2M	38.2M	1.1M	0.0M	37.1M	37.1M	37.1M	0.0M	0.0M	0.0M
ERX1946712	34.8M	34.8M	34.8M	0.9M	0.0M	34.0M	34.0M	34.0M	0.0M	0.0M	0.0M
ERX1946713	46.5M	46.5M	46.5M	1.2M	0.0M	45.3M	45.2M	45.2M	0.0M	0.0M	0.0M
ERX1946714	41.1M	41.1M	41.1M	1.1M	5.8M	40.0M	40.0M	40.0M	0.0M	0.0M	0.0M
ERX1946715	39.5M	39.5M	39.5M	0.9M	0.0M	38.6M	38.6M	38.6M	0.0M	0.0M	0.0M
ERX1946716	43.6M	43.6M	43.6M	1.0M	0.0M	42.6M	42.6M	42.6M	0.0M	0.0M	0.0M
ERX1946717	39.4M	39.4M	39.4M	0.9M	6.3M	38.5M	38.4M	38.4M	0.0M	0.0M	0.0M
ERX1946718	43.5M	43.5M	43.5M	1.0M	7.0M	42.5M	42.5M	42.5M	0.0M	0.0M	0.0M
ERX1946719	50.8M	50.8M	50.8M	1.1M	0.0M	49.7M	49.7M	49.7M	0.0M	0.0M	0.0M
ERX1946720	40.3M	40.3M	40.3M	0.9M	6.4M	39.4M	39.4M	39.4M	0.0M	0.0M	0.0M
ERX1946721	36.8M	36.8M	36.8M	0.9M	5.8M	35.8M	35.8M	35.8M	0.0M	0.0M	0.0M
ERX1946722	36.4M	36.4M	36.4M	0.9M	5.5M	35.5M	35.5M	35.5M	0.0M	0.0M	0.0M
ERX1946723	41.6M	41.6M	41.6M	1.1M	6.6M	40.5M	40.5M	40.5M	0.0M	0.0M	0.0M
ERX1946724	43.5M	43.5M	43.5M	1.1M	7.5M	42.3M	42.3M	42.3M	0.0M	0.0M	0.0M
ERX1946725	41.4M	41.4M	41.4M	1.1M	6.9M	40.3M	40.3M	40.3M	0.0M	0.0M	0.0M
ERX1946726	46.4M	46.4M	46.4M	1.3M	0.0M	45.1M	45.1M	45.1M	0.0M	0.0M	0.0M
ERX1946727	50.4M	50.4M	50.4M	1.4M	0.0M	49.0M	49.0M	49.0M	0.0M	0.0M	0.0M
ERX1946728	42.4M	42.4M	42.4M	1.3M	0.0M	41.1M	41.1M	41.1M	0.0M	0.0M	0.0M
ERX1946729	38.2M	38.2M	38.2M	1.0M	0.0M	37.2M	37.2M	37.2M	0.0M	0.0M	0.0M
ERX1946730	43.4M	43.4M	43.4M	1.2M	0.0M	42.2M	42.2M	42.2M	0.0M	0.0M	0.0M
ERX1946731	39.6M	39.6M	39.6M	1.1M	0.0M	38.4M	38.4M	38.4M	0.0M	0.0M	0.0M
ERX1946732	42.7M	42.7M	42.7M	1.3M	6.9M	41.5M	41.5M	41.5M	0.0M	0.0M	0.0M
ERX1946733	43.9M	43.9M	43.9M	1.2M	0.0M	42.6M	42.6M	42.6M	0.0M	0.0M	0.0M
ERX1946734	47.5M	47.5M	47.5M	1.5M	0.0M	46.0M	46.0M	46.0M	0.0M	0.0M	0.0M
ERX1946735	43.1M	43.1M	43.1M	1.3M	9.5M	41.8M	41.8M	41.8M	0.0M	0.0M	0.0M
ERX1946736	41.7M	41.7M	41.7M	1.2M	8.5M	40.5M	40.5M	40.5M	0.0M	0.0M	0.0M
ERX1946737	37.3M	37.3M	37.3M	1.0M	0.0M	36.3M	36.3M	36.3M	0.0M	0.0M	0.0M
ERX1946738	35.7M	35.7M	35.7M	0.9M	5.3M	34.8M	34.8M	34.8M	0.0M	0.0M	0.0M
ERX1946739	42.4M	42.4M	42.4M	1.1M	5.4M	41.3M	41.3M	41.3M	0.0M	0.0M	0.0M
ERX1946740	51.3M	51.3M	51.3M	1.4M	0.0M	49.9M	49.9M	49.9M	0.0M	0.0M	0.0M
ERX1946741	47.6M	47.6M	47.6M	1.1M	8.2M	46.5M	46.5M	46.5M	0.0M	0.0M	0.0M
ERX1946742	53.1M	53.1M	53.1M	1.3M	0.0M	51.9M	51.9M	51.9M	0.0M	0.0M	0.0M
ERX1946743	49.1M	49.1M	49.1M	1.2M	0.0M	47.9M	47.8M	47.8M	0.0M	0.0M	0.0M
ERX1946744	47.1M	47.1M	47.1M	1.1M	8.0M	46.0M	46.0M	46.0M	0.0M	0.0M	0.0M
ERX1946745	43.2M	43.2M	43.2M	1.0M	6.9M	42.2M	42.2M	42.2M	0.0M	0.0M	0.0M
ERX1946746	42.4M	42.4M	42.4M	0.9M	6.2M	41.5M	41.4M	41.4M	0.0M	0.0M	0.0M
ERX1946747	33.7M	33.7M	33.7M	0.8M	0.0M	32.8M	32.8M	32.8M	0.0M	0.0M	0.0M
ERX1946748	33.6M	33.6M	33.6M	0.8M	0.0M	32.7M	32.7M	32.7M	0.0M	0.0M	0.0M
ERX1946749	34.1M	34.1M	34.1M	0.9M	0.0M	33.2M	33.2M	33.2M	0.0M	0.0M	0.0M
ERX1946750	33.8M	33.8M	33.8M	0.8M	5.2M	33.0M	33.0M	33.0M	0.0M	0.0M	0.0M
ERX1946751	33.7M	33.7M	33.7M	0.8M	0.0M	32.9M	32.9M	32.9M	0.0M	0.0M	0.0M
ERX1946752	34.2M	34.2M	34.2M	0.8M	5.3M	33.4M	33.4M	33.4M	0.0M	0.0M	0.0M
ERX1946753	45.7M	45.7M	45.7M	1.1M	7.6M	44.5M	44.5M	44.5M	0.0M	0.0M	0.0M
ERX1946754	45.5M	45.5M	45.5M	1.1M	7.5M	44.4M	44.4M	44.4M	0.0M	0.0M	0.0M
ERX1946755	46.1M	46.1M	46.1M	1.2M	0.0M	45.0M	45.0M	45.0M	0.0M	0.0M	0.0M
ERX1946756	50.4M	50.4M	50.4M	1.3M	9.3M	49.1M	49.1M	49.1M	0.0M	0.0M	0.0M
ERX1946757	50.2M	50.2M	50.2M	1.3M	0.0M	48.9M	48.9M	48.9M	0.0M	0.0M	0.0M
ERX1946758	50.8M	50.8M	50.8M	1.3M	0.0M	49.5M	49.5M	49.5M	0.0M	0.0M	0.0M
ERX1946759	45.5M	45.5M	45.5M	1.2M	0.0M	44.3M	44.3M	44.3M	0.0M	0.0M	0.0M
ERX1946760	45.4M	45.4M	45.4M	1.2M	8.1M	44.1M	44.1M	44.1M	0.0M	0.0M	0.0M
ERX1946761	46.0M	46.0M	46.0M	1.2M	8.3M	44.8M	44.8M	44.8M	0.0M	0.0M	0.0M
ERX1946762	34.1M	34.1M	34.1M	0.9M	6.2M	33.2M	33.2M	33.2M	0.0M	0.0M	0.0M
ERX1946763	34.0M	34.0M	34.0M	0.9M	6.1M	33.1M	33.0M	33.0M	0.0M	0.0M	0.0M
ERX1946764	34.4M	34.4M	34.4M	0.9M	6.3M	33.5M	33.5M	33.5M	0.0M	0.0M	0.0M
ERX1946765	35.4M	35.4M	35.4M	0.9M	0.0M	34.5M	34.5M	34.5M	0.0M	0.0M	0.0M
ERX1946766	35.3M	35.3M	35.3M	0.9M	5.4M	34.4M	34.4M	34.4M	0.0M	0.0M	0.0M
ERX1946767	35.6M	35.6M	35.6M	0.9M	0.0M	34.7M	34.7M	34.7M	0.0M	0.0M	0.0M
ERX1946768	44.2M	44.2M	44.2M	1.2M	8.0M	43.0M	43.0M	43.0M	0.0M	0.0M	0.0M
ERX1946769	44.0M	44.0M	44.0M	1.1M	0.0M	42.9M	42.9M	42.9M	0.0M	0.0M	0.0M
ERX1946770	44.7M	44.7M	44.7M	1.2M	0.0M	43.5M	43.5M	43.5M	0.0M	0.0M	0.0M
ERX1946771	57.6M	57.6M	57.6M	2.0M	11.3M	55.6M	55.5M	55.5M	0.0M	0.0M	0.0M
ERX1946772	57.5M	57.5M	57.5M	2.1M	0.0M	55.4M	55.3M	55.3M	0.0M	0.0M	0.0M
ERX1946773	58.1M	58.1M	58.1M	2.1M	11.5M	56.0M	56.0M	56.0M	0.0M	0.0M	0.0M
ERX1946774	37.6M	37.6M	37.6M	0.9M	0.0M	36.7M	36.7M	36.7M	0.0M	0.0M	0.0M
ERX1946775	38.2M	38.2M	38.2M	1.0M	0.0M	37.1M	37.1M	37.1M	0.0M	0.0M	0.0M
ERX1946776	35.9M	35.9M	35.9M	1.1M	5.4M	34.8M	34.8M	34.8M	0.0M	0.0M	0.0M
ERX1946777	29.0M	29.0M	29.0M	0.8M	0.0M	28.2M	28.2M	28.2M	0.0M	0.0M	0.0M
ERX1946778	34.6M	34.6M	34.6M	1.0M	0.0M	33.6M	33.6M	33.6M	0.0M	0.0M	0.0M
ERX1946779	30.4M	30.4M	30.4M	0.8M	5.5M	29.7M	29.7M	29.7M	0.0M	0.0M	0.0M
ERX1946780	45.9M	45.9M	45.9M	1.3M	9.2M	44.7M	44.7M	44.7M	0.0M	0.0M	0.0M
ERX1946781	30.6M	30.6M	30.6M	0.8M	4.7M	29.8M	29.8M	29.8M	0.0M	0.0M	0.0M
ERX1946782	31.1M	31.1M	31.1M	0.8M	0.0M	30.3M	30.3M	30.3M	0.0M	0.0M	0.0M
ERX1946783	32.0M	32.0M	32.0M	1.2M	0.0M	30.8M	30.7M	30.7M	0.0M	0.0M	0.0M
ERX1946784	33.4M	33.4M	33.4M	0.7M	0.0M	32.7M	32.7M	32.7M	0.0M	0.0M	0.0M
ERX1946785	35.5M	35.5M	35.5M	0.8M	4.7M	34.7M	34.7M	34.7M	0.0M	0.0M	0.0M
ERX1946786	31.6M	31.6M	31.6M	0.6M	0.0M	31.0M	31.0M	31.0M	0.0M	0.0M	0.0M
ERX1946787	35.8M	35.8M	35.8M	1.0M	5.5M	34.8M	34.8M	34.8M	0.0M	0.0M	0.0M
ERX1946788	39.4M	39.4M	39.4M	1.7M	6.6M	37.7M	37.7M	37.7M	0.0M	0.0M	0.0M
ERX1946789	34.3M	34.3M	34.3M	1.1M	5.5M	33.3M	33.2M	33.2M	0.0M	0.0M	0.0M
ERX1946790	48.0M	48.0M	48.0M	1.3M	0.0M	46.7M	46.7M	46.7M	0.0M	0.0M	0.0M
ERX1946791	43.9M	43.9M	43.9M	0.9M	0.0M	43.0M	43.0M	43.0M	0.0M	0.0M	0.0M
ERX1946792	34.4M	34.4M	34.4M	0.7M	0.0M	33.6M	33.6M	33.6M	0.0M	0.0M	0.0M
ERX1946793	35.7M	35.7M	35.7M	0.8M	0.0M	34.8M	34.8M	34.8M	0.0M	0.0M	0.0M
ERX1946794	40.4M	40.4M	40.4M	0.9M	0.0M	39.5M	39.5M	39.5M	0.0M	0.0M	0.0M
ERX1946795	35.5M	35.5M	35.5M	0.9M	0.0M	34.7M	34.6M	34.6M	0.0M	0.0M	0.0M
ERX1946796	41.1M	41.1M	41.1M	0.9M	6.5M	40.2M	40.1M	40.1M	0.0M	0.0M	0.0M
ERX1946797	46.7M	46.7M	46.7M	1.2M	8.5M	45.5M	45.5M	45.5M	0.0M	0.0M	0.0M
ERX1946798	41.2M	41.2M	41.2M	0.9M	0.0M	40.3M	40.2M	40.2M	0.0M	0.0M	0.0M
ERX1946799	40.3M	40.3M	40.3M	0.9M	6.4M	39.4M	39.4M	39.4M	0.0M	0.0M	0.0M
ERX1946800	40.6M	40.6M	40.6M	1.1M	0.0M	39.5M	39.5M	39.5M	0.0M	0.0M	0.0M
ERX1946801	39.0M	39.0M	39.0M	1.2M	5.0M	37.8M	37.8M	37.8M	0.0M	0.0M	0.0M
ERX1946802	33.1M	33.1M	33.1M	0.9M	0.0M	32.1M	32.1M	32.1M	0.0M	0.0M	0.0M
ERX1946803	35.0M	35.0M	35.0M	0.9M	0.0M	34.1M	34.1M	34.1M	0.0M	0.0M	0.0M
ERX1946804	36.3M	36.3M	36.3M	1.0M	0.0M	35.3M	35.3M	35.3M	0.0M	0.0M	0.0M
ERX1946805	38.4M	38.4M	38.4M	1.1M	8.1M	37.3M	37.3M	37.3M	0.0M	0.0M	0.0M
ERX1946806	32.3M	32.3M	32.3M	0.8M	5.9M	31.5M	31.5M	31.5M	0.0M	0.0M	0.0M
ERX1946807	38.1M	38.1M	38.1M	1.1M	0.0M	37.0M	37.0M	37.0M	0.0M	0.0M	0.0M
ERX1946808	35.1M	35.1M	35.1M	0.9M	0.0M	34.2M	34.2M	34.2M	0.0M	0.0M	0.0M
ERX1946809	45.2M	45.2M	45.2M	1.2M	0.0M	44.0M	44.0M	44.0M	0.0M	0.0M	0.0M
ERX1946810	38.9M	38.9M	38.9M	1.0M	5.3M	37.9M	37.9M	37.9M	0.0M	0.0M	0.0M
ERX1946811	38.4M	38.4M	38.4M	0.9M	5.0M	37.5M	37.5M	37.5M	0.0M	0.0M	0.0M
ERX1946812	42.5M	42.5M	42.5M	1.0M	0.0M	41.5M	41.5M	41.5M	0.0M	0.0M	0.0M
ERX1946813	38.5M	38.5M	38.5M	0.9M	6.0M	37.6M	37.5M	37.5M	0.0M	0.0M	0.0M
ERX1946814	42.6M	42.6M	42.6M	0.9M	0.0M	41.7M	41.7M	41.7M	0.0M	0.0M	0.0M
ERX1946815	50.1M	50.1M	50.1M	1.1M	8.5M	49.0M	48.9M	48.9M	0.0M	0.0M	0.0M
ERX1946816	39.4M	39.4M	39.4M	0.9M	0.0M	38.5M	38.5M	38.5M	0.0M	0.0M	0.0M
ERX1946817	35.0M	35.0M	35.0M	0.9M	5.4M	34.1M	34.1M	34.1M	0.0M	0.0M	0.0M
ERX1946818	34.6M	34.6M	34.6M	0.8M	0.0M	33.8M	33.8M	33.8M	0.0M	0.0M	0.0M
ERX1946819	39.4M	39.4M	39.4M	1.0M	6.1M	38.4M	38.4M	38.4M	0.0M	0.0M	0.0M
ERX1946820	40.8M	40.8M	40.8M	1.0M	6.9M	39.8M	39.7M	39.7M	0.0M	0.0M	0.0M
ERX1946821	39.1M	39.1M	39.1M	1.0M	6.3M	38.1M	38.1M	38.1M	0.0M	0.0M	0.0M
ERX1946822	44.0M	44.0M	44.0M	1.2M	0.0M	42.8M	42.8M	42.8M	0.0M	0.0M	0.0M
ERX1946823	47.7M	47.7M	47.7M	1.3M	9.1M	46.4M	46.3M	46.3M	0.0M	0.0M	0.0M
ERX1946824	40.2M	40.2M	40.2M	1.1M	7.1M	39.1M	39.0M	39.0M	0.0M	0.0M	0.0M
ERX1946825	36.3M	36.3M	36.3M	0.9M	0.0M	35.4M	35.4M	35.4M	0.0M	0.0M	0.0M
ERX1946826	41.3M	41.3M	41.3M	1.1M	6.3M	40.3M	40.2M	40.2M	0.0M	0.0M	0.0M
ERX1946827	37.2M	37.2M	37.2M	1.0M	4.9M	36.2M	36.2M	36.2M	0.0M	0.0M	0.0M
ERX1946828	40.8M	40.8M	40.8M	1.2M	0.0M	39.6M	39.6M	39.6M	0.0M	0.0M	0.0M
ERX1946829	41.9M	41.9M	41.9M	1.1M	7.2M	40.8M	40.8M	40.8M	0.0M	0.0M	0.0M
ERX1946830	45.4M	45.4M	45.4M	1.3M	9.7M	44.1M	44.1M	44.1M	0.0M	0.0M	0.0M
ERX1946831	41.3M	41.3M	41.3M	1.2M	9.0M	40.1M	40.1M	40.1M	0.0M	0.0M	0.0M
ERX1946832	40.3M	40.3M	40.3M	1.1M	0.0M	39.2M	39.2M	39.2M	0.0M	0.0M	0.0M
ERX1946833	35.9M	35.9M	35.9M	0.9M	0.0M	34.9M	34.9M	34.9M	0.0M	0.0M	0.0M
ERX1946834	34.0M	34.0M	34.0M	0.8M	5.0M	33.2M	33.2M	33.2M	0.0M	0.0M	0.0M
ERX1946835	41.2M	41.2M	41.2M	1.1M	0.0M	40.1M	40.1M	40.1M	0.0M	0.0M	0.0M
ERX1946836	49.5M	49.5M	49.5M	1.3M	0.0M	48.2M	48.2M	48.2M	0.0M	0.0M	0.0M
ERX1946837	46.1M	46.1M	46.1M	1.1M	7.8M	45.0M	45.0M	45.0M	0.0M	0.0M	0.0M
ERX1946838	51.2M	51.2M	51.2M	1.2M	0.0M	50.0M	50.0M	50.0M	0.0M	0.0M	0.0M
ERX1946839	47.3M	47.3M	47.3M	1.2M	0.0M	46.2M	46.2M	46.2M	0.0M	0.0M	0.0M
ERX1946840	45.6M	45.6M	45.6M	1.0M	7.6M	44.6M	44.5M	44.5M	0.0M	0.0M	0.0M
ERX1946841	41.5M	41.5M	41.5M	0.9M	0.0M	40.6M	40.6M	40.6M	0.0M	0.0M	0.0M
ERX1946842	40.9M	40.9M	40.9M	0.9M	5.9M	40.0M	40.0M	40.0M	0.0M	0.0M	0.0M
ERX1946843	42.2M	42.2M	42.2M	1.0M	5.6M	41.2M	41.2M	41.2M	0.0M	0.0M	0.0M
ERX1946844	41.1M	41.1M	41.1M	1.2M	0.0M	39.9M	39.9M	39.9M	0.0M	0.0M	0.0M
ERX1946845	40.1M	40.1M	40.1M	1.2M	6.4M	39.0M	39.0M	39.0M	0.0M	0.0M	0.0M
ERX1946846	33.0M	33.0M	33.0M	0.9M	5.3M	32.1M	32.1M	32.1M	0.0M	0.0M	0.0M
ERX1946847	39.3M	39.3M	39.3M	1.1M	0.0M	38.1M	38.1M	38.1M	0.0M	0.0M	0.0M
ERX1946848	34.7M	34.7M	34.7M	0.9M	6.7M	33.8M	33.8M	33.8M	0.0M	0.0M	0.0M
ERX1946849	52.1M	52.1M	52.1M	1.5M	0.0M	50.6M	50.6M	50.6M	0.0M	0.0M	0.0M
ERX1946850	35.2M	35.2M	35.2M	1.0M	0.0M	34.2M	34.2M	34.2M	0.0M	0.0M	0.0M
ERX1946851	34.9M	34.9M	34.9M	0.9M	5.3M	34.0M	34.0M	34.0M	0.0M	0.0M	0.0M
ERX1946852	36.3M	36.3M	36.3M	1.4M	5.4M	34.9M	34.9M	34.9M	0.0M	0.0M	0.0M
ERX1946853	37.7M	37.7M	37.7M	0.8M	0.0M	36.9M	36.9M	36.9M	0.0M	0.0M	0.0M
ERX1946854	40.5M	40.5M	40.5M	0.9M	0.0M	39.6M	39.6M	39.6M	0.0M	0.0M	0.0M
ERX1946855	36.1M	36.1M	36.1M	0.7M	0.0M	35.4M	35.3M	35.3M	0.0M	0.0M	0.0M
ERX1946856	41.7M	41.7M	41.7M	1.2M	6.9M	40.5M	40.5M	40.5M	0.0M	0.0M	0.0M
ERX1946857	44.6M	44.6M	44.6M	2.0M	0.0M	42.6M	42.6M	42.6M	0.0M	0.0M	0.0M
ERX1946858	39.2M	39.2M	39.2M	1.2M	6.7M	38.0M	38.0M	38.0M	0.0M	0.0M	0.0M
ERX1946859	55.7M	55.7M	55.7M	1.5M	0.0M	54.2M	54.2M	54.2M	0.0M	0.0M	0.0M
ERX1946860	45.2M	45.2M	45.2M	0.9M	6.9M	44.3M	44.3M	44.3M	0.0M	0.0M	0.0M
ERX1946861	35.1M	35.1M	35.1M	0.8M	0.0M	34.3M	34.3M	34.3M	0.0M	0.0M	0.0M
ERX1946862	36.6M	36.6M	36.6M	0.8M	5.3M	35.8M	35.8M	35.8M	0.0M	0.0M	0.0M
ERX1946863	41.8M	41.8M	41.8M	0.9M	0.0M	40.9M	40.9M	40.9M	0.0M	0.0M	0.0M
ERX1946864	36.7M	36.7M	36.7M	0.8M	0.0M	35.8M	35.8M	35.8M	0.0M	0.0M	0.0M
ERX1946865	42.3M	42.3M	42.3M	0.9M	0.0M	41.3M	41.3M	41.3M	0.0M	0.0M	0.0M
ERX1946866	47.7M	47.7M	47.7M	1.2M	0.0M	46.5M	46.5M	46.5M	0.0M	0.0M	0.0M
ERX1946867	42.2M	42.2M	42.2M	0.9M	7.4M	41.3M	41.2M	41.2M	0.0M	0.0M	0.0M
ERX1946868	41.4M	41.4M	41.4M	0.9M	0.0M	40.5M	40.5M	40.5M	0.0M	0.0M	0.0M
ERX1946869	44.6M	44.6M	44.6M	1.2M	7.4M	43.4M	43.4M	43.4M	0.0M	0.0M	0.0M
ERX1946870	42.7M	42.7M	42.7M	1.2M	5.8M	41.4M	41.4M	41.4M	0.0M	0.0M	0.0M
ERX1946871	36.3M	36.3M	36.3M	1.0M	5.1M	35.2M	35.2M	35.2M	0.0M	0.0M	0.0M
ERX1946872	38.9M	38.9M	38.9M	1.1M	6.4M	37.8M	37.8M	37.8M	0.0M	0.0M	0.0M
ERX1946873	41.1M	41.1M	41.1M	1.1M	0.0M	40.0M	40.0M	40.0M	0.0M	0.0M	0.0M
ERX1946874	42.0M	42.0M	42.0M	1.2M	0.0M	40.7M	40.7M	40.7M	0.0M	0.0M	0.0M
ERX1946875	36.0M	36.0M	36.0M	1.0M	6.9M	35.0M	35.0M	35.0M	0.0M	0.0M	0.0M
ERX1946876	43.7M	43.7M	43.7M	1.2M	8.4M	42.5M	42.4M	42.4M	0.0M	0.0M	0.0M
ERX1946877	39.7M	39.7M	39.7M	1.0M	0.0M	38.7M	38.7M	38.7M	0.0M	0.0M	0.0M
ERX1946878	50.1M	50.1M	50.1M	1.3M	7.5M	48.7M	48.7M	48.7M	0.0M	0.0M	0.0M
ERX1946879	41.0M	41.0M	41.0M	1.0M	0.0M	40.0M	40.0M	40.0M	0.0M	0.0M	0.0M
ERX1946880	42.5M	42.5M	42.5M	1.0M	5.9M	41.5M	41.5M	41.5M	0.0M	0.0M	0.0M
ERX1946881	47.7M	47.7M	47.7M	1.1M	7.8M	46.7M	46.7M	46.7M	0.0M	0.0M	0.0M
ERX1946882	43.2M	43.2M	43.2M	1.0M	0.0M	42.2M	42.2M	42.2M	0.0M	0.0M	0.0M
ERX1946883	48.4M	48.4M	48.4M	1.0M	0.0M	47.3M	47.3M	47.3M	0.0M	0.0M	0.0M
ERX1946884	55.9M	55.9M	55.9M	1.3M	10.0M	54.6M	54.6M	54.6M	0.0M	0.0M	0.0M
ERX1946885	44.2M	44.2M	44.2M	1.0M	7.3M	43.2M	43.1M	43.1M	0.0M	0.0M	0.0M
ERX1946886	36.0M	36.0M	36.0M	0.9M	5.6M	35.1M	35.1M	35.1M	0.0M	0.0M	0.0M
ERX1946887	36.1M	36.1M	36.1M	0.9M	5.4M	35.2M	35.2M	35.2M	0.0M	0.0M	0.0M
ERX1946888	41.3M	41.3M	41.3M	1.1M	0.0M	40.2M	40.2M	40.2M	0.0M	0.0M	0.0M
ERX1946889	43.1M	43.1M	43.1M	1.1M	7.4M	42.0M	42.0M	42.0M	0.0M	0.0M	0.0M
ERX1946890	40.7M	40.7M	40.7M	1.1M	0.0M	39.7M	39.7M	39.7M	0.0M	0.0M	0.0M
ERX1946891	45.5M	45.5M	45.5M	1.2M	8.3M	44.3M	44.2M	44.2M	0.0M	0.0M	0.0M
ERX1946892	49.7M	49.7M	49.7M	1.3M	9.7M	48.4M	48.4M	48.4M	0.0M	0.0M	0.0M
ERX1946893	41.9M	41.9M	41.9M	1.2M	7.5M	40.7M	40.7M	40.7M	0.0M	0.0M	0.0M
ERX1946894	37.6M	37.6M	37.6M	1.0M	6.3M	36.7M	36.6M	36.6M	0.0M	0.0M	0.0M
ERX1946895	43.4M	43.4M	43.4M	1.1M	0.0M	42.3M	42.3M	42.3M	0.0M	0.0M	0.0M
ERX1946896	38.6M	38.6M	38.6M	1.1M	0.0M	37.5M	37.5M	37.5M	0.0M	0.0M	0.0M
ERX1946897	42.8M	42.8M	42.8M	1.2M	7.0M	41.5M	41.5M	41.5M	0.0M	0.0M	0.0M
ERX1946898	44.1M	44.1M	44.1M	1.2M	0.0M	43.0M	42.9M	42.9M	0.0M	0.0M	0.0M
ERX1946899	47.9M	47.9M	47.9M	1.5M	0.0M	46.5M	46.4M	46.4M	0.0M	0.0M	0.0M
ERX1946900	43.5M	43.5M	43.5M	1.3M	0.0M	42.3M	42.2M	42.2M	0.0M	0.0M	0.0M
ERX1946901	41.9M	41.9M	41.9M	1.1M	8.6M	40.8M	40.8M	40.8M	0.0M	0.0M	0.0M
ERX1946902	37.4M	37.4M	37.4M	1.0M	6.4M	36.5M	36.5M	36.5M	0.0M	0.0M	0.0M
ERX1946903	35.7M	35.7M	35.7M	0.9M	0.0M	34.8M	34.8M	34.8M	0.0M	0.0M	0.0M
ERX1946904	44.2M	44.2M	44.2M	1.2M	0.0M	43.1M	43.1M	43.1M	0.0M	0.0M	0.0M
ERX1946905	53.5M	53.5M	53.5M	1.4M	0.0M	52.1M	52.0M	52.0M	0.0M	0.0M	0.0M
ERX1946906	50.3M	50.3M	50.3M	1.2M	9.0M	49.1M	49.1M	49.1M	0.0M	0.0M	0.0M
ERX1946907	55.6M	55.6M	55.6M	1.3M	9.0M	54.3M	54.3M	54.3M	0.0M	0.0M	0.0M
ERX1946908	53.0M	53.0M	53.0M	1.3M	0.0M	51.7M	51.6M	51.6M	0.0M	0.0M	0.0M
ERX1946909	48.8M	48.8M	48.8M	1.1M	8.5M	47.6M	47.6M	47.6M	0.0M	0.0M	0.0M
ERX1946910	45.0M	45.0M	45.0M	1.0M	7.4M	44.0M	44.0M	44.0M	0.0M	0.0M	0.0M
ERX1946911	45.5M	45.5M	45.5M	1.0M	7.0M	44.5M	44.5M	44.5M	0.0M	0.0M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-flagstat-dp_table-1

Sort	Column	Description	ID	Scale
\|\|	Total Reads	Total Reads	`flagstat_total`	read_count
\|\|	Total Passed QC	Total Passed QC	`total_passed`	read_count
\|\|	Mapped	Mapped	`mapped_passed`	read_count
\|\|	Secondary Alignments	Secondary Alignments	`secondary_passed`	read_count
\|\|	Duplicates	Duplicates	`duplicates_passed`	read_count
\|\|	Paired in Sequencing	Paired in Sequencing	`paired_in_sequencing_passed`	read_count
\|\|	Properly Paired	Properly Paired	`properly_paired_passed`	read_count
\|\|	Self and mate mapped	Reads with itself and mate mapped	`with_itself_and_mate_mapped_passed`	read_count
\|\|	Singletons	Singletons	`singletons_passed`	read_count
\|\|	Mate mapped to diff chr	Mate mapped to different chromosome	`with_mate_mapped_to_a_different_chr_passed`	read_count
\|\|	Diff chr (mapQ >= 5)	Mate mapped to different chromosome (mapQ >= 5)	`with_mate_mapped_to_a_different_chr_mapQ_5__passed`	read_count

Mapped reads per contig

The samtools idxstats tool counts the number of mapped reads per chromosome / contig. Chromosomes with < 0.1% of the total aligned reads are omitted from this plot.

Created with MultiQC

STAR

Universal RNA-seq aligner.URL: https://github.com/alexdobin/STARDOI: 10.1093/bioinformatics/bts635

Summary Statistics

Summary statistics from the STAR alignment

Showing ⁰/₂₃₄ rows and ¹⁰/₁₉ columns.

Sample Name	Total reads	Aligned	Aligned	Uniq aligned	Uniq aligned	Multimapped	Avg. read len	Avg. mapped len	Splices	Annotated splices	GT/AG splices	GC/AG splices	AT/AC splices	Non-canonical splices	Mismatch rate	Del rate	Del len	Ins rate	Ins len
ERX1946678	19.8M	19.6M	98.9%	19.3M	97.4%	0.3M	180.0bp	180.3bp	13.1M	13.1M	13.0M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946679	20.1M	19.9M	98.9%	19.5M	97.1%	0.4M	180.0bp	180.2bp	13.5M	13.5M	13.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946680	18.7M	18.5M	99.0%	18.2M	97.0%	0.4M	180.0bp	180.3bp	12.7M	12.7M	12.6M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946681	15.2M	15.0M	98.9%	14.7M	97.2%	0.3M	180.0bp	180.2bp	10.2M	10.2M	10.0M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946682	18.1M	17.9M	99.0%	17.5M	97.0%	0.4M	180.0bp	180.2bp	11.7M	11.6M	11.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946683	16.1M	15.9M	98.9%	15.6M	96.9%	0.3M	180.0bp	180.2bp	10.0M	10.0M	9.9M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946684	24.0M	23.8M	99.0%	23.4M	97.1%	0.5M	180.0bp	180.1bp	15.0M	15.0M	14.8M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946685	16.1M	15.9M	99.0%	15.6M	97.2%	0.3M	180.0bp	180.3bp	10.4M	10.4M	10.3M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946686	16.4M	16.2M	98.9%	15.9M	97.2%	0.3M	180.0bp	180.3bp	10.9M	10.9M	10.8M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946687	16.4M	16.2M	99.1%	15.7M	95.8%	0.5M	181.0bp	180.6bp	10.4M	10.4M	10.3M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946688	17.5M	17.3M	98.7%	17.0M	97.2%	0.3M	181.0bp	180.4bp	11.3M	11.3M	11.2M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946689	18.6M	18.4M	98.9%	18.1M	97.4%	0.3M	181.0bp	180.6bp	12.0M	12.0M	11.9M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946690	16.7M	16.5M	99.0%	16.3M	97.6%	0.2M	181.0bp	180.6bp	10.4M	10.4M	10.3M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946691	18.7M	18.4M	98.4%	18.0M	96.2%	0.4M	182.0bp	182.2bp	11.7M	11.7M	11.6M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946692	20.2M	20.0M	99.0%	19.2M	95.2%	0.8M	180.0bp	180.5bp	12.2M	12.2M	12.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946693	17.7M	17.5M	98.9%	17.1M	96.5%	0.4M	181.0bp	180.6bp	11.1M	11.1M	11.0M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946694	24.9M	24.5M	98.7%	24.0M	96.6%	0.5M	180.0bp	180.4bp	16.0M	16.0M	15.8M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946695	22.9M	22.7M	99.0%	22.4M	97.7%	0.3M	179.0bp	179.5bp	15.1M	15.1M	14.9M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946696	17.9M	17.7M	98.9%	17.4M	97.4%	0.3M	179.0bp	179.4bp	11.7M	11.6M	11.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946697	18.4M	18.3M	99.0%	18.0M	97.4%	0.3M	179.0bp	179.5bp	12.1M	12.1M	12.0M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946698	21.0M	20.8M	98.9%	20.4M	97.4%	0.3M	179.0bp	179.4bp	14.0M	13.9M	13.8M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946699	18.4M	18.2M	98.9%	17.9M	97.3%	0.3M	179.0bp	179.4bp	11.8M	11.8M	11.6M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946700	21.2M	21.0M	98.9%	20.7M	97.3%	0.3M	179.0bp	179.4bp	13.6M	13.6M	13.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946701	24.0M	23.7M	98.9%	23.3M	97.1%	0.4M	179.0bp	179.3bp	15.5M	15.4M	15.3M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946702	21.3M	21.1M	99.0%	20.7M	97.5%	0.3M	179.0bp	179.3bp	14.0M	14.0M	13.8M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946703	20.9M	20.7M	99.0%	20.4M	97.5%	0.3M	179.0bp	179.5bp	13.4M	13.4M	13.2M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946704	20.2M	19.9M	98.5%	19.5M	96.8%	0.4M	180.0bp	179.8bp	13.7M	13.7M	13.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946705	19.8M	19.5M	98.5%	19.2M	96.7%	0.4M	180.0bp	179.8bp	13.6M	13.6M	13.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946706	16.5M	16.3M	98.5%	16.0M	96.7%	0.3M	180.0bp	179.7bp	11.4M	11.4M	11.2M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946707	18.0M	17.7M	98.6%	17.4M	96.8%	0.3M	180.0bp	179.8bp	12.3M	12.3M	12.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946708	18.0M	17.7M	98.8%	17.4M	96.8%	0.4M	180.0bp	179.7bp	11.9M	11.8M	11.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946709	19.1M	18.9M	98.7%	18.5M	96.8%	0.4M	180.0bp	179.8bp	12.3M	12.3M	12.2M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946710	16.3M	16.1M	98.8%	15.8M	96.9%	0.3M	180.0bp	179.8bp	10.5M	10.5M	10.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946711	18.8M	18.6M	98.7%	18.2M	96.8%	0.4M	180.0bp	179.8bp	12.3M	12.3M	12.2M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946712	17.2M	17.0M	98.6%	16.7M	97.0%	0.3M	180.0bp	179.7bp	11.8M	11.8M	11.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946713	22.9M	22.6M	98.8%	22.2M	97.1%	0.4M	180.0bp	180.0bp	15.2M	15.2M	15.1M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946714	20.3M	20.0M	98.6%	19.7M	96.9%	0.3M	180.0bp	180.0bp	13.4M	13.4M	13.2M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946715	19.5M	19.3M	98.9%	19.0M	97.3%	0.3M	180.0bp	180.0bp	12.8M	12.8M	12.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946716	21.6M	21.3M	98.6%	21.0M	97.1%	0.3M	180.0bp	179.9bp	13.9M	13.9M	13.8M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946717	19.4M	19.2M	98.9%	18.9M	97.2%	0.3M	180.0bp	180.0bp	12.6M	12.6M	12.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946718	21.6M	21.3M	98.6%	20.9M	97.1%	0.3M	180.0bp	179.9bp	14.3M	14.3M	14.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946719	25.2M	24.9M	98.7%	24.5M	97.2%	0.4M	180.0bp	179.8bp	16.7M	16.7M	16.5M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946720	20.0M	19.7M	98.7%	19.4M	97.1%	0.3M	180.0bp	179.8bp	13.3M	13.3M	13.2M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946721	18.2M	17.9M	98.7%	17.6M	97.0%	0.3M	180.0bp	179.9bp	12.4M	12.4M	12.3M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946722	18.0M	17.8M	98.6%	17.5M	97.0%	0.3M	180.0bp	179.8bp	12.2M	12.2M	12.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946723	20.5M	20.3M	98.6%	19.9M	96.9%	0.4M	180.0bp	179.8bp	13.9M	13.9M	13.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946724	21.5M	21.2M	98.4%	20.8M	96.7%	0.4M	180.0bp	179.8bp	14.6M	14.6M	14.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946725	20.5M	20.2M	98.5%	19.8M	96.8%	0.3M	180.0bp	179.9bp	13.9M	13.9M	13.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946726	22.8M	22.5M	98.8%	22.1M	96.9%	0.4M	180.0bp	179.9bp	15.4M	15.4M	15.3M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946727	24.9M	24.5M	98.6%	24.1M	96.7%	0.5M	180.0bp	179.8bp	16.9M	16.9M	16.7M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946728	20.9M	20.6M	98.6%	20.2M	96.5%	0.4M	180.0bp	179.8bp	14.0M	14.0M	13.8M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946729	18.9M	18.6M	98.7%	18.3M	97.0%	0.3M	180.0bp	179.9bp	12.8M	12.8M	12.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946730	21.4M	21.1M	98.7%	20.7M	97.0%	0.4M	180.0bp	180.1bp	14.6M	14.6M	14.4M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946731	19.5M	19.2M	98.6%	18.9M	96.8%	0.4M	180.0bp	180.0bp	13.3M	13.3M	13.2M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946732	21.0M	20.7M	98.7%	20.3M	96.8%	0.4M	180.0bp	180.1bp	14.5M	14.5M	14.3M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946733	21.6M	21.3M	98.7%	20.9M	96.9%	0.4M	180.0bp	180.0bp	14.8M	14.8M	14.6M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946734	23.3M	23.0M	98.7%	22.5M	96.6%	0.5M	180.0bp	180.0bp	15.4M	15.4M	15.2M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946735	21.2M	20.9M	98.6%	20.5M	96.6%	0.4M	180.0bp	180.0bp	13.6M	13.6M	13.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946736	20.6M	20.3M	98.6%	19.9M	96.6%	0.4M	180.0bp	179.9bp	13.2M	13.2M	13.0M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946737	18.4M	18.2M	98.6%	17.8M	96.8%	0.3M	180.0bp	179.9bp	12.1M	12.1M	12.0M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946738	17.6M	17.4M	98.7%	17.1M	97.0%	0.3M	180.0bp	180.1bp	12.1M	12.1M	11.9M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946739	21.0M	20.7M	98.6%	20.3M	96.8%	0.4M	180.0bp	179.7bp	13.6M	13.6M	13.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946740	25.2M	25.0M	98.9%	24.5M	97.2%	0.4M	180.0bp	179.9bp	16.5M	16.5M	16.3M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946741	23.5M	23.2M	98.9%	22.9M	97.4%	0.4M	180.0bp	179.8bp	15.3M	15.3M	15.2M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946742	26.3M	25.9M	98.6%	25.5M	97.1%	0.4M	180.0bp	179.8bp	17.1M	17.0M	16.9M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946743	24.3M	23.9M	98.7%	23.5M	96.9%	0.4M	180.0bp	179.8bp	15.9M	15.9M	15.7M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946744	23.4M	23.0M	98.5%	22.6M	96.9%	0.4M	180.0bp	179.7bp	15.3M	15.3M	15.2M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946745	21.4M	21.1M	98.8%	20.8M	97.2%	0.3M	180.0bp	179.7bp	14.3M	14.3M	14.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946746	21.0M	20.7M	98.6%	20.4M	97.2%	0.3M	180.0bp	179.7bp	14.1M	14.1M	13.9M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946747	16.6M	16.4M	98.7%	16.2M	97.1%	0.3M	197.0bp	196.4bp	12.4M	12.4M	12.3M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.2bp
ERX1946748	16.6M	16.4M	98.6%	16.1M	97.0%	0.3M	197.0bp	196.4bp	12.3M	12.3M	12.2M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.2bp
ERX1946749	16.8M	16.6M	98.6%	16.3M	97.0%	0.3M	197.0bp	196.3bp	12.5M	12.5M	12.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.2bp
ERX1946750	16.7M	16.5M	98.8%	16.3M	97.3%	0.3M	197.0bp	196.9bp	12.6M	12.6M	12.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946751	16.7M	16.5M	98.8%	16.2M	97.2%	0.3M	197.0bp	196.9bp	12.5M	12.5M	12.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946752	16.9M	16.7M	98.8%	16.4M	97.2%	0.3M	197.0bp	196.9bp	12.7M	12.7M	12.6M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946753	22.5M	22.3M	98.9%	21.9M	97.2%	0.4M	197.0bp	196.9bp	16.7M	16.7M	16.6M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946754	22.4M	22.2M	98.9%	21.8M	97.2%	0.4M	197.0bp	196.9bp	16.7M	16.7M	16.5M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946755	22.7M	22.5M	98.9%	22.1M	97.2%	0.4M	197.0bp	196.8bp	16.9M	16.9M	16.7M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946756	24.8M	24.6M	99.0%	24.1M	97.3%	0.4M	197.0bp	196.9bp	18.5M	18.5M	18.3M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946757	24.7M	24.5M	99.0%	24.0M	97.3%	0.4M	197.0bp	196.9bp	18.5M	18.4M	18.2M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946758	25.0M	24.8M	99.0%	24.3M	97.3%	0.4M	197.0bp	196.9bp	18.7M	18.7M	18.5M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946759	22.5M	22.2M	98.5%	21.8M	96.8%	0.4M	197.0bp	196.7bp	16.7M	16.7M	16.5M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946760	22.4M	22.1M	98.5%	21.7M	96.7%	0.4M	197.0bp	196.7bp	16.6M	16.6M	16.4M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946761	22.7M	22.4M	98.5%	22.0M	96.8%	0.4M	197.0bp	196.6bp	16.9M	16.8M	16.7M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946762	16.7M	16.6M	99.2%	16.3M	97.4%	0.3M	197.0bp	196.9bp	12.6M	12.6M	12.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946763	16.7M	16.5M	99.2%	16.2M	97.4%	0.3M	197.0bp	196.8bp	12.5M	12.5M	12.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946764	16.9M	16.8M	99.2%	16.5M	97.4%	0.3M	197.0bp	196.8bp	12.6M	12.6M	12.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946765	17.4M	17.3M	99.0%	17.0M	97.2%	0.3M	197.0bp	197.0bp	12.0M	12.0M	11.9M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946766	17.4M	17.2M	99.0%	16.9M	97.3%	0.3M	197.0bp	197.0bp	12.0M	12.0M	11.9M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946767	17.6M	17.4M	99.0%	17.1M	97.2%	0.3M	197.0bp	196.9bp	12.1M	12.1M	12.0M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946768	21.8M	21.5M	98.9%	21.1M	97.1%	0.4M	198.0bp	197.0bp	15.8M	15.8M	15.6M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946769	21.7M	21.4M	98.8%	21.1M	97.1%	0.4M	198.0bp	197.0bp	15.7M	15.7M	15.6M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946770	22.0M	21.8M	98.9%	21.4M	97.1%	0.4M	198.0bp	197.0bp	16.0M	16.0M	15.8M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946771	28.1M	27.8M	98.8%	27.0M	96.0%	0.8M	197.0bp	196.7bp	20.4M	20.4M	20.2M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946772	28.0M	27.7M	98.8%	26.9M	96.0%	0.8M	197.0bp	196.6bp	20.3M	20.3M	20.1M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946773	28.4M	28.0M	98.8%	27.2M	96.0%	0.8M	197.0bp	196.6bp	20.6M	20.5M	20.3M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946774	18.5M	18.4M	99.3%	18.1M	97.9%	0.3M	193.0bp	193.4bp	13.3M	13.3M	13.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946775	18.7M	18.6M	99.3%	18.2M	97.5%	0.3M	193.0bp	193.1bp	13.6M	13.6M	13.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946776	17.5M	17.4M	99.4%	17.1M	97.5%	0.3M	193.0bp	193.3bp	12.9M	12.9M	12.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946777	14.2M	14.1M	99.3%	13.9M	97.6%	0.2M	193.0bp	193.1bp	10.3M	10.3M	10.2M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946778	16.9M	16.8M	99.4%	16.5M	97.3%	0.3M	193.0bp	193.2bp	11.8M	11.8M	11.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946779	14.9M	14.8M	99.3%	14.6M	97.5%	0.3M	193.0bp	193.1bp	10.1M	10.1M	10.0M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946780	22.5M	22.4M	99.4%	21.9M	97.5%	0.4M	193.0bp	192.8bp	15.2M	15.2M	15.0M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946781	15.0M	14.9M	99.4%	14.6M	97.6%	0.3M	193.0bp	193.2bp	10.5M	10.5M	10.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946782	15.3M	15.1M	99.3%	14.9M	97.6%	0.3M	193.0bp	193.5bp	11.0M	11.0M	10.9M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946783	15.5M	15.4M	99.4%	14.9M	96.3%	0.5M	194.0bp	194.3bp	10.7M	10.7M	10.6M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946784	16.5M	16.3M	99.1%	16.1M	97.7%	0.2M	194.0bp	194.3bp	11.6M	11.6M	11.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946785	17.5M	17.3M	98.9%	17.1M	97.4%	0.3M	200.0bp	200.0bp	12.5M	12.5M	12.3M	0.1M	0.0M	0.0M	0.3%	0.0%	1.4bp	0.0%	1.1bp
ERX1946786	15.6M	15.5M	99.3%	15.3M	98.0%	0.2M	194.0bp	194.3bp	10.6M	10.6M	10.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946787	17.6M	17.4M	99.1%	17.0M	96.9%	0.4M	194.0bp	194.2bp	11.9M	11.9M	11.8M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946788	19.0M	18.9M	99.4%	18.2M	95.6%	0.7M	194.0bp	194.1bp	12.5M	12.5M	12.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946789	16.8M	16.6M	99.2%	16.2M	96.8%	0.4M	194.0bp	194.2bp	11.5M	11.5M	11.3M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946790	23.6M	23.4M	99.1%	22.9M	97.1%	0.5M	194.0bp	194.1bp	16.5M	16.5M	16.4M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946791	21.7M	21.5M	99.4%	21.2M	98.0%	0.3M	192.0bp	191.9bp	15.4M	15.4M	15.2M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946792	16.9M	16.8M	99.2%	16.6M	97.8%	0.3M	191.0bp	191.4bp	11.9M	11.9M	11.8M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946793	17.6M	17.4M	99.3%	17.2M	97.7%	0.3M	191.0bp	191.6bp	12.4M	12.4M	12.3M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946794	19.9M	19.8M	99.3%	19.5M	97.8%	0.3M	191.0bp	191.3bp	14.3M	14.3M	14.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946795	17.5M	17.3M	99.3%	17.1M	97.7%	0.3M	191.0bp	191.5bp	12.1M	12.1M	11.9M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946796	20.2M	20.1M	99.3%	19.8M	97.7%	0.3M	191.0bp	191.6bp	14.0M	14.0M	13.8M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946797	23.0M	22.8M	99.2%	22.4M	97.5%	0.4M	191.0bp	191.2bp	16.0M	16.0M	15.8M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946798	20.3M	20.1M	99.3%	19.8M	97.8%	0.3M	191.0bp	191.3bp	14.4M	14.4M	14.2M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946799	19.8M	19.7M	99.3%	19.4M	97.8%	0.3M	192.0bp	191.7bp	13.7M	13.7M	13.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946800	20.0M	19.8M	98.9%	19.4M	97.1%	0.3M	188.0bp	188.3bp	14.4M	14.4M	14.2M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946801	19.1M	18.9M	98.9%	18.6M	97.0%	0.4M	188.0bp	188.4bp	13.8M	13.8M	13.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946802	16.3M	16.1M	98.8%	15.8M	97.0%	0.3M	188.0bp	188.0bp	11.8M	11.8M	11.7M	0.1M	0.0M	0.0M	0.2%	0.0%	1.4bp	0.0%	1.1bp
ERX1946803	17.3M	17.1M	98.9%	16.8M	97.2%	0.3M	188.0bp	188.4bp	12.5M	12.4M	12.3M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946804	17.8M	17.7M	99.1%	17.3M	97.2%	0.3M	188.0bp	188.0bp	12.4M	12.4M	12.3M	0.1M	0.0M	0.0M	0.2%	0.0%	1.4bp	0.0%	1.1bp
ERX1946805	18.8M	18.7M	99.0%	18.3M	97.0%	0.4M	188.0bp	188.4bp	12.8M	12.8M	12.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946806	15.9M	15.7M	99.1%	15.4M	97.2%	0.3M	188.0bp	188.0bp	10.8M	10.8M	10.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946807	18.7M	18.5M	99.1%	18.2M	97.2%	0.4M	188.0bp	188.5bp	13.0M	13.0M	12.9M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946808	17.3M	17.1M	99.0%	16.8M	97.3%	0.3M	188.0bp	188.0bp	12.5M	12.5M	12.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946809	22.2M	22.0M	99.2%	21.6M	97.5%	0.4M	192.0bp	192.0bp	15.9M	15.9M	15.7M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946810	19.2M	19.0M	99.0%	18.6M	97.3%	0.3M	192.0bp	192.0bp	13.6M	13.6M	13.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946811	18.9M	18.8M	99.2%	18.5M	97.6%	0.3M	192.0bp	192.1bp	13.4M	13.4M	13.2M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946812	21.0M	20.8M	99.0%	20.5M	97.5%	0.3M	192.0bp	191.8bp	14.6M	14.6M	14.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946813	18.9M	18.8M	99.2%	18.5M	97.5%	0.3M	192.0bp	192.0bp	13.2M	13.2M	13.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946814	21.1M	20.9M	98.9%	20.6M	97.5%	0.3M	192.0bp	191.9bp	15.1M	15.0M	14.9M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946815	24.7M	24.5M	99.0%	24.1M	97.5%	0.4M	191.0bp	191.5bp	17.6M	17.6M	17.4M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946816	19.5M	19.3M	99.0%	19.0M	97.5%	0.3M	192.0bp	191.6bp	14.0M	14.0M	13.8M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946817	17.2M	17.1M	99.1%	16.8M	97.4%	0.3M	194.0bp	193.9bp	12.8M	12.8M	12.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946818	17.1M	16.9M	99.0%	16.6M	97.3%	0.3M	194.0bp	193.7bp	12.6M	12.6M	12.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946819	19.4M	19.2M	99.0%	18.9M	97.2%	0.3M	194.0bp	193.6bp	14.2M	14.2M	14.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946820	20.1M	19.9M	98.8%	19.5M	97.0%	0.3M	194.0bp	193.8bp	14.9M	14.9M	14.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946821	19.3M	19.1M	98.9%	18.8M	97.2%	0.3M	194.0bp	193.9bp	14.2M	14.2M	14.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946822	21.6M	21.4M	99.2%	21.0M	97.3%	0.4M	194.0bp	193.9bp	15.9M	15.9M	15.8M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946823	23.4M	23.2M	98.9%	22.8M	97.1%	0.4M	194.0bp	193.9bp	17.3M	17.3M	17.1M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946824	19.8M	19.5M	98.9%	19.2M	97.0%	0.4M	194.0bp	193.7bp	14.4M	14.4M	14.3M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946825	17.9M	17.7M	99.0%	17.4M	97.3%	0.3M	194.0bp	193.9bp	13.2M	13.2M	13.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946826	20.3M	20.1M	99.1%	19.8M	97.4%	0.3M	194.0bp	194.2bp	15.1M	15.1M	15.0M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946827	18.3M	18.1M	99.0%	17.8M	97.2%	0.3M	194.0bp	194.1bp	13.6M	13.6M	13.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946828	20.0M	19.8M	99.1%	19.5M	97.2%	0.4M	194.0bp	194.1bp	15.0M	15.0M	14.9M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946829	20.6M	20.4M	99.1%	20.0M	97.3%	0.4M	194.0bp	193.9bp	15.4M	15.4M	15.2M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946830	22.3M	22.1M	99.1%	21.6M	97.2%	0.4M	194.0bp	194.0bp	16.0M	16.0M	15.8M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946831	20.3M	20.1M	99.0%	19.7M	97.0%	0.4M	194.0bp	193.9bp	14.1M	14.1M	14.0M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946832	19.8M	19.6M	99.0%	19.2M	97.1%	0.4M	194.0bp	193.7bp	13.8M	13.8M	13.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946833	17.6M	17.5M	99.1%	17.2M	97.3%	0.3M	194.0bp	193.7bp	12.6M	12.6M	12.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946834	16.8M	16.6M	99.1%	16.3M	97.5%	0.3M	194.0bp	194.0bp	12.5M	12.5M	12.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946835	20.3M	20.1M	99.0%	19.7M	97.3%	0.3M	192.0bp	192.0bp	14.3M	14.3M	14.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946836	24.3M	24.1M	99.3%	23.7M	97.6%	0.4M	193.0bp	192.7bp	17.2M	17.2M	17.0M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946837	22.7M	22.5M	99.3%	22.2M	97.8%	0.4M	192.0bp	192.5bp	16.0M	16.0M	15.8M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946838	25.3M	25.0M	99.0%	24.6M	97.5%	0.4M	192.0bp	192.3bp	17.7M	17.7M	17.5M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946839	23.3M	23.1M	99.0%	22.7M	97.3%	0.4M	192.0bp	192.4bp	16.5M	16.5M	16.4M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946840	22.5M	22.3M	98.9%	21.9M	97.3%	0.4M	192.0bp	192.2bp	16.0M	16.0M	15.8M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946841	20.5M	20.3M	99.1%	20.0M	97.6%	0.3M	192.0bp	192.3bp	14.8M	14.8M	14.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946842	20.2M	20.0M	99.1%	19.7M	97.6%	0.3M	192.0bp	192.4bp	14.7M	14.6M	14.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946843	20.8M	20.6M	99.2%	20.3M	97.8%	0.3M	197.0bp	197.3bp	15.1M	15.1M	15.0M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946844	20.1M	20.0M	99.2%	19.6M	97.4%	0.4M	197.0bp	197.2bp	14.9M	14.9M	14.7M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946845	19.6M	19.5M	99.3%	19.1M	97.4%	0.4M	197.0bp	197.3bp	14.7M	14.7M	14.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946846	16.2M	16.1M	99.2%	15.8M	97.5%	0.3M	197.0bp	197.2bp	11.9M	11.9M	11.8M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946847	19.2M	19.1M	99.3%	18.7M	97.3%	0.4M	197.0bp	197.2bp	13.7M	13.7M	13.5M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946848	17.0M	16.9M	99.2%	16.6M	97.4%	0.3M	197.0bp	197.2bp	11.7M	11.7M	11.6M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946849	25.5M	25.3M	99.3%	24.8M	97.3%	0.5M	197.0bp	197.1bp	17.4M	17.4M	17.3M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946850	17.2M	17.1M	99.3%	16.8M	97.4%	0.3M	197.0bp	197.3bp	12.3M	12.3M	12.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946851	17.2M	17.0M	99.2%	16.7M	97.5%	0.3M	197.0bp	197.4bp	12.6M	12.6M	12.4M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946852	17.6M	17.5M	99.3%	16.9M	96.1%	0.6M	198.0bp	197.7bp	12.3M	12.3M	12.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946853	18.6M	18.4M	99.0%	18.2M	97.6%	0.3M	198.0bp	197.5bp	13.3M	13.3M	13.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.2bp
ERX1946854	20.0M	19.8M	99.2%	19.5M	97.7%	0.3M	198.0bp	197.6bp	14.2M	14.2M	14.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946855	17.8M	17.7M	99.2%	17.4M	97.9%	0.2M	198.0bp	197.7bp	12.3M	12.3M	12.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946856	20.5M	20.3M	99.0%	19.8M	96.8%	0.5M	198.0bp	197.5bp	14.0M	14.0M	13.9M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946857	21.5M	21.3M	99.3%	20.5M	95.5%	0.8M	198.0bp	197.6bp	14.3M	14.3M	14.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946858	19.2M	19.0M	99.2%	18.5M	96.7%	0.5M	198.0bp	197.6bp	13.2M	13.2M	13.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946859	27.4M	27.1M	99.0%	26.5M	96.9%	0.6M	198.0bp	197.5bp	19.4M	19.4M	19.2M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946860	22.3M	22.2M	99.3%	21.9M	98.0%	0.3M	197.0bp	196.9bp	16.2M	16.2M	16.0M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946861	17.3M	17.2M	99.2%	16.9M	97.7%	0.3M	197.0bp	196.7bp	12.4M	12.4M	12.3M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946862	18.1M	17.9M	99.2%	17.6M	97.7%	0.3M	197.0bp	196.8bp	13.0M	13.0M	12.9M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946863	20.6M	20.5M	99.2%	20.2M	97.7%	0.3M	197.0bp	196.7bp	15.1M	15.1M	15.0M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946864	18.1M	17.9M	99.2%	17.6M	97.6%	0.3M	197.0bp	196.8bp	12.7M	12.7M	12.6M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946865	20.8M	20.7M	99.2%	20.3M	97.6%	0.3M	197.0bp	196.8bp	14.7M	14.7M	14.5M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946866	23.4M	23.3M	99.2%	22.8M	97.4%	0.4M	197.0bp	196.6bp	16.7M	16.7M	16.5M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946867	20.8M	20.6M	99.2%	20.3M	97.7%	0.3M	197.0bp	196.7bp	15.0M	15.0M	14.9M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946868	20.4M	20.3M	99.2%	20.0M	97.7%	0.3M	197.0bp	196.9bp	14.4M	14.4M	14.2M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946869	22.0M	21.7M	98.8%	21.3M	97.1%	0.4M	196.0bp	195.9bp	16.4M	16.3M	16.2M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946870	21.0M	20.7M	98.9%	20.3M	97.0%	0.4M	196.0bp	195.9bp	15.7M	15.7M	15.5M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946871	17.8M	17.6M	98.8%	17.3M	97.0%	0.3M	196.0bp	195.8bp	13.4M	13.4M	13.3M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946872	19.1M	18.9M	98.9%	18.6M	97.1%	0.3M	196.0bp	195.9bp	14.3M	14.3M	14.1M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946873	20.2M	20.0M	99.1%	19.6M	97.2%	0.4M	196.0bp	195.9bp	14.6M	14.6M	14.4M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946874	20.6M	20.4M	99.0%	20.0M	97.0%	0.4M	196.0bp	196.0bp	14.5M	14.5M	14.3M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946875	17.7M	17.5M	99.1%	17.2M	97.2%	0.3M	196.0bp	195.9bp	12.5M	12.5M	12.3M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946876	21.4M	21.2M	99.0%	20.8M	97.1%	0.4M	196.0bp	196.1bp	15.4M	15.4M	15.3M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946877	19.6M	19.3M	98.9%	19.0M	97.2%	0.3M	196.0bp	195.8bp	14.7M	14.7M	14.5M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946878	24.6M	24.4M	99.1%	23.9M	97.3%	0.4M	197.0bp	196.8bp	18.0M	18.0M	17.8M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946879	20.2M	20.0M	98.9%	19.7M	97.2%	0.3M	197.0bp	196.8bp	14.7M	14.7M	14.5M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946880	21.0M	20.8M	99.1%	20.4M	97.6%	0.3M	197.0bp	196.8bp	15.1M	15.1M	14.9M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946881	23.6M	23.3M	98.9%	23.0M	97.4%	0.4M	197.0bp	196.6bp	16.8M	16.8M	16.6M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946882	21.3M	21.1M	99.2%	20.7M	97.4%	0.4M	197.0bp	196.8bp	15.2M	15.2M	15.0M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946883	23.9M	23.7M	98.9%	23.3M	97.4%	0.4M	197.0bp	196.7bp	17.4M	17.4M	17.2M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946884	27.6M	27.3M	99.0%	26.9M	97.4%	0.4M	197.0bp	196.5bp	20.1M	20.1M	19.9M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946885	21.8M	21.6M	99.0%	21.3M	97.4%	0.3M	197.0bp	196.6bp	16.0M	16.0M	15.8M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946886	17.7M	17.6M	99.0%	17.3M	97.3%	0.3M	197.0bp	197.3bp	13.4M	13.4M	13.2M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946887	17.8M	17.6M	98.9%	17.3M	97.3%	0.3M	197.0bp	197.2bp	13.3M	13.2M	13.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946888	20.3M	20.1M	98.9%	19.8M	97.2%	0.3M	197.0bp	197.1bp	15.1M	15.1M	15.0M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946889	21.3M	21.0M	98.7%	20.7M	97.0%	0.4M	197.0bp	197.2bp	16.0M	15.9M	15.8M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946890	20.1M	19.8M	98.8%	19.5M	97.1%	0.3M	197.0bp	197.3bp	15.0M	15.0M	14.8M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946891	22.3M	22.1M	99.1%	21.7M	97.2%	0.4M	197.0bp	197.4bp	16.6M	16.6M	16.5M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946892	24.5M	24.2M	98.8%	23.8M	97.0%	0.4M	197.0bp	197.3bp	18.3M	18.3M	18.1M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946893	20.6M	20.4M	98.8%	19.9M	96.8%	0.4M	197.0bp	197.2bp	15.2M	15.2M	15.1M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946894	18.5M	18.3M	99.0%	18.0M	97.2%	0.3M	197.0bp	197.3bp	13.9M	13.9M	13.7M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946895	21.4M	21.2M	99.0%	20.8M	97.3%	0.4M	198.0bp	197.5bp	16.1M	16.1M	15.9M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946896	19.0M	18.8M	98.9%	18.4M	97.1%	0.3M	197.0bp	197.4bp	14.3M	14.3M	14.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946897	21.0M	20.8M	99.0%	20.4M	97.1%	0.4M	197.0bp	197.4bp	15.9M	15.9M	15.7M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946898	21.7M	21.5M	99.0%	21.1M	97.2%	0.4M	197.0bp	197.4bp	16.4M	16.4M	16.2M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946899	23.5M	23.2M	99.0%	22.7M	97.0%	0.5M	197.0bp	197.4bp	17.1M	17.0M	16.9M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946900	21.4M	21.1M	98.9%	20.7M	96.9%	0.4M	197.0bp	197.4bp	15.1M	15.1M	14.9M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946901	20.6M	20.4M	98.9%	20.0M	97.0%	0.4M	197.0bp	197.3bp	14.6M	14.6M	14.4M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946902	18.4M	18.3M	99.0%	17.9M	97.2%	0.3M	197.0bp	197.3bp	13.4M	13.4M	13.2M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946903	17.6M	17.4M	99.0%	17.1M	97.4%	0.3M	197.0bp	197.4bp	13.3M	13.3M	13.1M	0.1M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946904	21.8M	21.5M	98.9%	21.2M	97.2%	0.4M	196.0bp	196.4bp	15.6M	15.6M	15.4M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946905	26.2M	26.0M	99.2%	25.6M	97.5%	0.5M	197.0bp	196.9bp	18.8M	18.8M	18.6M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946906	24.7M	24.6M	99.3%	24.2M	97.7%	0.4M	197.0bp	196.7bp	17.8M	17.8M	17.6M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946907	27.5M	27.2M	99.0%	26.7M	97.4%	0.4M	197.0bp	196.6bp	19.6M	19.5M	19.3M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946908	26.1M	25.8M	99.0%	25.4M	97.2%	0.5M	197.0bp	196.7bp	18.8M	18.8M	18.6M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946909	24.1M	23.8M	98.9%	23.4M	97.2%	0.4M	197.0bp	196.5bp	17.4M	17.4M	17.2M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946910	22.2M	22.0M	99.1%	21.7M	97.6%	0.3M	197.0bp	196.6bp	16.3M	16.3M	16.1M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp
ERX1946911	22.5M	22.3M	99.0%	21.9M	97.5%	0.3M	197.0bp	196.7bp	16.5M	16.5M	16.3M	0.2M	0.0M	0.0M	0.1%	0.0%	1.4bp	0.0%	1.1bp

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: star_summary_table_table

Sort	Column	Description	ID	Scale
\|\|	Total reads	Number of input reads	`star-total_reads`	read_count
\|\|	Aligned	Mapped reads	`star-mapped`	read_count
\|\|	Aligned	% Mapped reads	`star-mapped_percent`
\|\|	Uniq aligned	Uniquely mapped reads	`star-uniquely_mapped`	read_count
\|\|	Uniq aligned	% Uniquely mapped reads	`star-uniquely_mapped_percent`
\|\|	Multimapped	Multiple mapped reads	`star-multimapped`	read_count
\|\|	Avg. read len	Average input read length	`star-avg_input_read_length`
\|\|	Avg. mapped len	Average mapped length	`star-avg_mapped_read_length`
\|\|	Splices	Number of splices: Total	`star-num_splices`	read_count
\|\|	Annotated splices	Number of splices: Annotated (sjdb)	`star-num_annotated_splices`	read_count
\|\|	GT/AG splices	Number of splices: GT/AG	`star-num_GTAG_splices`	read_count
\|\|	GC/AG splices	Number of splices: GC/AG	`star-num_GCAG_splices`	read_count
\|\|	AT/AC splices	Number of splices: AT/AC	`star-num_ATAC_splices`	read_count
\|\|	Non-canonical splices	Number of splices: Non-canonical	`star-num_noncanonical_splices`	read_count
\|\|	Mismatch rate	Mismatch rate per base	`star-mismatch_rate`
\|\|	Del rate	Deletion rate per base	`star-deletion_rate`
\|\|	Del len	Deletion average length	`star-deletion_length`
\|\|	Ins rate	Insertion rate per base	`star-insertion_rate`
\|\|	Ins len	Insertion average length	`star-insertion_length`

Alignment Scores

Created with MultiQC

Sample relationships

Plots interrogating sample relationships, based on final count matrices.

STAR_SALMON DESeq2 sample similarity

Min:

Max:

Created with MultiQC

STAR_SALMON DESeq2 PCA plot

Created with MultiQC

Biotype Counts

Biotype Counts shows reads overlapping genomic features of different biotypes, counted by featureCounts.

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
BEDTOOLS_GENOMECOV_FW	bedtools	`2.31.1`
CUSTOM_GETCHROMSIZES	getchromsizes	`1.21`
CUSTOM_TX2GENE	python	`3.10.4`
DESEQ2_QC_STAR_SALMON	bioconductor-deseq2	`1.28.0`
	r-base	`4.0.3`
DupRadar	bioconductor-dupradar	`1.32.0`
FASTQC	fastqc	`0.12.1`
FQ_LINT	fq	`0.12.0 (2024-07-08)`
FQ_SUBSAMPLE	fq	`0.12.0 (2024-07-08)`
GTF2BED	perl	`5.26.2`
GTF_FILTER	python	`3.9.5`
GUNZIP_FASTA	gunzip	`1.1`
GUNZIP_GTF	gunzip	`1.1`
MAKE_TRANSCRIPTS_FASTA	rsem	`1.3.1`
	star	`2.7.10a`
MULTIQC_CUSTOM_BIOTYPE	python	`3.9.5`
PICARD_MARKDUPLICATES	picard	`3.1.1`
QUALIMAP_RNASEQ	qualimap	`2.3`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SALMON_INDEX	salmon	`1.10.3`
SALMON_QUANT	salmon	`1.10.3`
SAMTOOLS_FLAGSTAT	samtools	`1.21`
SAMTOOLS_IDXSTATS	samtools	`1.21`
SAMTOOLS_INDEX	samtools	`1.21`
SAMTOOLS_SORT	samtools	`1.21`
SAMTOOLS_STATS	samtools	`1.21`
SE_GENE	bioconductor-summarizedexperiment	`1.32.0`
STAR_ALIGN	gawk	`5.1.0`
	samtools	`1.21`
	star	`2.7.11b`
STAR_GENOMEGENERATE	gawk	`5.1.0`
	samtools	`1.21`
	star	`2.7.11b`
STRINGTIE_STRINGTIE	stringtie	`2.2.3`
SUBREAD_FEATURECOUNTS	subread	`2.0.6`
TRIMGALORE	cutadapt	`4.9`
	trimgalore	`0.6.10`
TXIMETA_TXIMPORT	bioconductor-tximeta	`1.20.1`
UCSC_BEDCLIP	ucsc	`377`
UCSC_BEDGRAPHTOBIGWIG	ucsc	`469`
Workflow	Nextflow	`24.10.1`
	nf-core/rnaseq	`v3.18.0-gb96a753`

nf-core/rnaseq Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.URL: https://github.com/nf-core/rnaseq

Methods

Data was processed using nf-core/rnaseq v3.18.0 (doi: 10.5281/zenodo.1400710) of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v24.10.1 (Di Tommaso et al., 2017) with the following command:

nextflow run nf-core/rnaseq --input /work/hartmaca/calixto/samplesheet_rnaseq.csv --outdir /work/hartmaca/calixto --fasta /data/laub-rna/hiwi/cajus/arabid_genome/Arabidopsis_thaliana.TAIR10.dna.toplevel.fa.gz --gtf /data/laub-rna/hiwi/cajus/arabid_genome/Arabidopsis_thaliana.TAIR10.60.gtf.gz -profile singularity

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnaseq Workflow Summary

- this information is collected when the pipeline is started.URL: https://github.com/nf-core/rnaseq

Input/output options

input: /work/hartmaca/calixto/samplesheet_rnaseq.csv
outdir: /work/hartmaca/calixto

Reference genome options

fasta: /data/laub-rna/hiwi/cajus/arabid_genome/Arabidopsis_thaliana.TAIR10.dna.toplevel.fa.gz
gtf: /data/laub-rna/hiwi/cajus/arabid_genome/Arabidopsis_thaliana.TAIR10.60.gtf.gz

Core Nextflow options

configFiles: N/A
containerEngine: singularity
launchDir: /gpfs1/work/hartmaca/calixto
profile: singularity
projectDir: /home/hartmaca/.nextflow/assets/nf-core/rnaseq
revision: master
runName: nasty_jang
userName: hartmaca
workDir: /gpfs1/work/hartmaca/calixto/work

Toggle navigation v1.25.1

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

Sample status checks

Strandedness Checks

Samples strandedness check: Columns

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Cutadapt

Filtered Reads

Trimmed Sequence Lengths (3') Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

DupRadar

Picard

Mark Duplicates Help

QualiMap

Genomic origin of reads Help

Gene Coverage Profile Help

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

RSeQC: Bam Stat: Columns

Samtools

Percent mapped Help

Alignment stats

Samtools: stats: Alignment Stats: Columns

Flagstat

Samtools: flagstat: read count: Columns

Mapped reads per contig

STAR

Summary Statistics

STAR: Summary Statistics: Columns

Alignment Scores

Sample relationships

STAR_SALMON DESeq2 sample similarity

STAR_SALMON DESeq2 PCA plot

Biotype Counts

Software Versions

nf-core/rnaseq Methods Description

v1.25.1

Highlight Samples

Rename Samples

Show / Hide Samples

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Trimmed Sequence Lengths (3')

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Mark Duplicates

Genomic origin of reads

Gene Coverage Profile

Percent mapped